banner10_1038X692

RNA/Folding Annotation

Available from Version: 1.0

This tool produces the secondary structure of a long (up to 1kb) RNA sequence and annotates it by highlighting up to 14 comma separated short sequences as required.

The tool produces a navigable image showing the position of miRNA candidate sequences on a precursor hairpin (see Figure below).

Hairpin for miR164
Hairpin Annotation Tool output showing miR164 precursor.

The tool can produce as many images as required when given a long (hairpin) sequence and optional short sequence(s) in that will be highlighted on the hairpin. These should be subsequences of the hairpin sequence. Each loaded hairpin can then be cycled through using the arrow buttons shown below.

Navigate through your list of hairpins with these buttons

A user has the option to save the current image or save all of the images loaded into the tool.

A user can also view the information regarding the state of the tool in the top right corner.

Hovering the mouse over this box will display the hairpin sequence

Here you can determine how many images are currently loaded and by hovering over the box a tool tip appears describing the hairpin sequence and the short read positions.

Colour of each sequence is controlled using the toggle buttons shown below:

Choose a colour for your sequence, the first toggle refers to the first short sequence in your list

To change the colour of a specific image in the list, select the sequence number and pick the colour from the chooser on the right.

The program will create secondary structure plots from any fasta formatted files that contain foldable RNA sequences, however, if the FASTA file is formatted in the same way as the miRCat output the miRNA and star sequence will be highlighted

The format in FASTA is as follows:

>maturemiRNA_SEQUENCE_miRNA*_SEQUENCE_CHROMOSOMEHEADER-PRECURSOR-START_COORD_END_COORD_MFE_VALUE_STRANDPLUSMINUS [Negative strand][Positive strand]

HAIRPIN

So all of the bold values will not change, and the non bold values must contain the required data. I have added an example below,

maturemiRNA: TTGAGCCGTGCCAATATCACG

miRNA*: AGATATTAGTGCGGTTCAATC

Chromosome header: “1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02″

PRECURSOR Start-End coord: 3961364, 3961453

Minimum Free Energy : -41.9

and it is on the negative strand

>maturemiRNA_TTGAGCCGTGCCAATATCACG_miRNA*_AGATATTAGTGCGGTTCAATC_1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02_PRECURSOR-START_3961364_END_3961453_MFE_-41.9_STRAND_- [Negative strand]
CGCGAGATATTAGTGCGGTTCAATCAAATAGTCGTCCTCTTAACTCATGGAGAACGGTGTTGTTCGATTGAGCCGTGCCAATATCACGCG

 

  • The sRNA Workbench

    Hi Anita,

    I just ran this sequence through on OSX and it worked ok for me. I have attached the image it generated:

    http://srna-workbench.cmp.uea.ac.uk/wp-content/uploads/2014/02/Anita.jpg

    I will test the program on ubuntu too because it is likely to be something in the setup of your OS that is causing an issue. Can you let me know
    1. Java version
    2. OS version

    and we can go from there.

    Best wishes,
    Matt

    • Anita

      Thank You Sir,
      Here is the information :
      Java Version: 1.7.0_51
      OS version: 13.04

      • The sRNA Workbench

        Hi Anita,

        Thanks for that information, is the java definitely Oracles official build? If you type java -version into a console window could you let me know the text it reports?

        What actual OS is the version code from? Is it a linux build?

        Best wishes,
        Matt

        • Anita

          Hello Sir,

          The information it shows on
          1) “java -version”
          java version “1.7.0_51″
          OpenJDK Runtime Environment (IcedTea 2.4.4) (7u51-2.4.4-0ubuntu0.13.04.2)
          OpenJDK 64-Bit Server VM (build 24.45-b08, mixed mode)
          2) Ubuntu Version:
          Distributor ID: Ubuntu
          Description: Ubuntu 13.04
          Release: 13.04
          Codename: raring

          • The sRNA Workbench

            Hi Anita,

            I am afraid the OpenJDK is not supported for this software. A few tests I have run seem to result in instability. Please install the Oracle build of Java (it is free from Oracle’s website) and re-run the program. Hopefully this will resolve your issue :)

            Cheers,
            Matt

  • Anita

    I was trying to run RNA Annotation tool of UEA sRNA Workbench, for that I am simply Pasting a pre sequence of a knowm miRNA and it mature sequence in Short Read Sequences box, but it is showing an error message that “hairpin Sequence did not fold”.

    • The sRNA Workbench

      Hi Anita,

      I did reply to your original message over on the tutorials page also. It should only return this error if the sequence returns no structure. Can you let me know the sequence and the miRNA code and I will have a look?

      Cheers, Matt

  • Alice Lunardon

    Hi Matt,
    it’s me again but new tool question!
    I would like to use this tool to visualize the hairpin structure of a sequence but I am not able to cut and paste a sequence into the “hairpin sequence” section inside the RNA folding/annotation tool, is it normal?
    I also tried by opening a txt file with my sequence but the program does not recognize the sequence.

    Thank you!

    Alice

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Alice,

      Good to hear from you again :) The hairpin tool actually reads FASTA data rather than text so it must be formatted with:
      >ID
      Sequence

      If you load the hairpins file that miRCat generates (export hairpins menu) then it will also highlight the miRNA and miRNA* sequence for you.

      But the copy paste is strange, I just checked it and it seemed ok. What does it do exactly when you try to paste it in?

      Cheers,
      Matt

      • Alice Lunardon

        Hi Matt,
        if I open a fasta file the program calculates the structure automatically , but I am not able to make it show in color part of the sequence of the hairpin.

        Trying to paste a sequence in the “hairpin sequence” place, it seems that the command “paste” does not work; it is the right-click that does not work…don’t know why!

        Thanks!

        Alice

        • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

          Hi Alice,

          Yes I have not yet added a right click paste menu onto this one yet. However, if you just paste in using ctrl + V (when you have copied the sequences, you can use ctrl+C for this) or if you are on OSX (Apple) you can use cmd+C for copy and cmd+V for paste. (You can paste the short sequences in like this also just separate each one with a comma).

          If you want to format files to use the colouring for many sequences I have added some information to the page above. You will find that hairpins files output by miRCat are automatically formatted in this way.

          Cheers,
          Matt

  • Nian LIU

    I have downloaded and installed your newest java based UEA sRNA 2.4.0. When I copy my result into RNA/Folding Annotation tool, it could not generate hairpin imagin. And I could not pipe my miRCat result into RNA/Folding Annotation tool. My computer’s OS is WIN7.

    • admin

      I am not sure what is causing that. I have just ran the software on my Windows 7 machine through an Arabidopsis data set as a test and it rendered the hairpins fine through the right click menu. Did you try performing a “Render All” operation through the buttons at the top of the interface? Or you could try outputting all the hairpins into a text file using the export menu (shortcut buttons are at the top of the interface) and copy pasting the desired hairpin sequence into the hairpin annotation text box.

      Where any errors displayed to you? Did the interface appear with no hairpin image?

  • Nian LIU

    Hi,When I use miRCat tool, I can not pipe my result into RNA/Folding Annotation tool and I can not see any hairpin imagines. What is wrong?

A suite of tools for analysing micro RNA and other small RNA data from High-Throughput Sequencing devices