Available from Version: 1.0
This tool produces the secondary structure of a long (up to 1kb) RNA sequence and annotates it by highlighting up to 14 comma separated short sequences as required.
The tool produces a navigable image showing the position of miRNA candidate sequences on a precursor hairpin (see Figure below).
The tool can produce as many images as required when given a long (hairpin) sequence and optional short sequence(s) in that will be highlighted on the hairpin. These should be subsequences of the hairpin sequence. Each loaded hairpin can then be cycled through using the arrow buttons shown below.
A user has the option to save the current image or save all of the images loaded into the tool.
A user can also view the information regarding the state of the tool in the top right corner.
Here you can determine how many images are currently loaded and by hovering over the box a tool tip appears describing the hairpin sequence and the short read positions.
Colour of each sequence is controlled using the toggle buttons shown below:
To change the colour of a specific image in the list, select the sequence number and pick the colour from the chooser on the right.
The program will create secondary structure plots from any fasta formatted files that contain foldable RNA sequences, however, if the FASTA file is formatted in the same way as the miRCat output the miRNA and star sequence will be highlighted
The format in FASTA is as follows:
>maturemiRNA_SEQUENCE_miRNA*_SEQUENCE_CHROMOSOMEHEADER-PRECURSOR-START_COORD_END_COORD_MFE_VALUE_STRANDPLUSMINUS [Negative strand][Positive strand]
HAIRPIN
So all of the bold values will not change, and the non bold values must contain the required data. I have added an example below,
maturemiRNA: TTGAGCCGTGCCAATATCACG
miRNA*: AGATATTAGTGCGGTTCAATC
Chromosome header: “1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02″
PRECURSOR Start-End coord: 3961364, 3961453
Minimum Free Energy : -41.9
and it is on the negative strand
>maturemiRNA_TTGAGCCGTGCCAATATCACG_miRNA*_AGATATTAGTGCGGTTCAATC_1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02_PRECURSOR-START_3961364_END_3961453_MFE_-41.9_STRAND_- [Negative strand]
CGCGAGATATTAGTGCGGTTCAATCAAATAGTCGTCCTCTTAACTCATGGAGAACGGTGTTGTTCGATTGAGCCGTGCCAATATCACGCG





Hi Matt,
it’s me again but new tool question!
I would like to use this tool to visualize the hairpin structure of a sequence but I am not able to cut and paste a sequence into the “hairpin sequence” section inside the RNA folding/annotation tool, is it normal?
I also tried by opening a txt file with my sequence but the program does not recognize the sequence.
Thank you!
Alice
Hi Alice,
Good to hear from you again
The hairpin tool actually reads FASTA data rather than text so it must be formatted with:
>ID
Sequence
If you load the hairpins file that miRCat generates (export hairpins menu) then it will also highlight the miRNA and miRNA* sequence for you.
But the copy paste is strange, I just checked it and it seemed ok. What does it do exactly when you try to paste it in?
Cheers,
Matt
Hi Matt,
if I open a fasta file the program calculates the structure automatically , but I am not able to make it show in color part of the sequence of the hairpin.
Trying to paste a sequence in the “hairpin sequence” place, it seems that the command “paste” does not work; it is the right-click that does not work…don’t know why!
Thanks!
Alice
Hi Alice,
Yes I have not yet added a right click paste menu onto this one yet. However, if you just paste in using ctrl + V (when you have copied the sequences, you can use ctrl+C for this) or if you are on OSX (Apple) you can use cmd+C for copy and cmd+V for paste. (You can paste the short sequences in like this also just separate each one with a comma).
If you want to format files to use the colouring for many sequences I have added some information to the page above. You will find that hairpins files output by miRCat are automatically formatted in this way.
Cheers,
Matt
I have downloaded and installed your newest java based UEA sRNA 2.4.0. When I copy my result into RNA/Folding Annotation tool, it could not generate hairpin imagin. And I could not pipe my miRCat result into RNA/Folding Annotation tool. My computer’s OS is WIN7.
I am not sure what is causing that. I have just ran the software on my Windows 7 machine through an Arabidopsis data set as a test and it rendered the hairpins fine through the right click menu. Did you try performing a “Render All” operation through the buttons at the top of the interface? Or you could try outputting all the hairpins into a text file using the export menu (shortcut buttons are at the top of the interface) and copy pasting the desired hairpin sequence into the hairpin annotation text box.
Where any errors displayed to you? Did the interface appear with no hairpin image?
Hi,When I use miRCat tool, I can not pipe my result into RNA/Folding Annotation tool and I can not see any hairpin imagines. What is wrong?