miRProf

Available from Version: 2.0

This tool determines normalised expression levels of sRNAs matching known miRNAs in miRBase. miRProf can also quickly and easily compare miRNA expression levels across multiple samples.

miRProf requires a set of sRNA samples and a genome file for input. The paths to the files representing the samples and the genome are entered at the top of the main dialog box. In addition, miRProf can be configured in a number of ways, which are described in the following paragraphs.

miRProf filters sRNA sequences in each sample before expression levels are computed. The user can specify criteria such as minimum sRNA size, maximum sRNA size and minimum abundance. In addition, all low-complexity sRNAs (sequences, which contain less than 3 distinct nucleotides) and sequences containing non-canonical nucleotides (e.g. ‘N’ for unknown nucleotide) are discarded. Finally, any sRNAs not aligning to the user-specified genome are discarded. Genome filtering is mandatory in order to provide a frame of reference for comparing sRNAs across multiple samples.

Filtered reads from each sample are then aligned to a (sub)set of miRBase mature sequences. The user has the option to partion mirBase mature sequence based on whether they originate from plant, animal or virus miRNA precursors. In addition, the user can optionally choose to include all sets for alignment. miRBase is constantly updated with new miRNAs reported from the field. Therefore, the user can select any version of miRBase for their specific experiments. The data download and management is automatically handled within the tool. All the user need do is type in the version they which to use in the parameters dialog box.

The sRNA to mature miRNA matching process can be controlled using a few parameters:

    • Overhangs allowed

When aligning sRNAs to mature sequences the aligning tool will fail to report a match if the short read (the sRNA) overhangs the long read (the miRNA), to circumvent this problem miRNAs are padded with “XXX” at the beginning and end of the sequence. sRNAs which overhang the actual mature sequence will then be treated as having a number of mismatches equal to the number of nucleotides, which overhang the miRNA. This behaviour occurs by default, but the user can switch this off by deselecting the “overhangs allowed” check box.

    • Mismatches allowed

The number of allowed mismatches is controlled using the “Mismatches allowed” text box. The default value here is 0, implying the sRNA must exact match somewhere within the mature sequence. The maximum number of mismatches allowed is capped at 3 to prevent huge numbers of meaningless results being recorded.

    • Only keep best match

Even with 1, 2, or 3 mismatches allowed many hits can be returned, these can be minimised by checking the “only keep best match” box, which instructs miRProf to discard all hits to a given miRNA that have less than the best number of mismatches (a smaller number of mismatches is considered “better” than a larger number).

The last part of miRProf configuration involves determining how the sRNAs that match known miRNAs should be grouped. The user has these options:

    • Group organisms

If checked, miRProf does not consider the organism from which the miRNA was found. Therefore, users who select this check box will see only a single organism being returned: (all-combined).

    • Group variants

If checked, matches to different variants of a single miRNA precursor family are combined into one, such as: arm, and copy number.

    • Group mature and star

If checked, matches to mature and star sequences of the derived from the same miRNA precursor are grouped into one.

    • Group mismatches

If checked, matches to the same miRNA are combined into a group regardless of the number of mismatches.

All miRProf configuration parameters can be saved and loaded from file by using the toolbar buttons at the top of parameter browser dialog. This functionality can help the user maintain consistency between separate runs and can be used as part of an experiment log book by automatically documenting the experimental setup.

Setting parameters for the miRProf tool

When the user has configured all the parameters to their satisfaction they can start miRProf by clicking on the “Start” button on the main dialog, or by selecting the “Start” menu item from the run menu. Once running miRProf can be cancelled at any time by clicking on the “Cancel” button or menu item. Note: cancelling a run may not be instant as execution must reach a safe position in the code before cleanly stopping the run.

After the run has completed the results for all samples is available in the main miRProf dialog as shown in the figure below. The configuration of the results table is highly dependent on the grouping options the user has selected. For example, if the user selected to “group organisms”, then the results table will initially only contain one row, called “all combined”. Otherwise the display shows each organism the sRNAs could be mapped to. By clicking on the organism entry, individual detected miRNAs are revealed. Again, the number of miRNAs displayed here can vary dramatically based on the grouping options selected by the user. Each row containing a detected miRNA will contain 4 columns for each sample: raw count (total number of reads in the sRNA dataset matching this miRNA), weighted count (total number of reads in sRNA dataset matching this miRNA divided by the number of times the matching sRNAs aligned to the genome), normalised count (weighted count divided by total number of reads in this sample multiplied by 1 million), and finally the actual sRNA sequences in this sample that matched the miRNA. Any row within the table can be copied by selecting it and then using “ctrl-c” or by bringing up a context menu and selecting the “Copy to Clipboard” item.

Displaying miRProf results

Now that the results are available to the user, miRProf can export two types of file: a results table in .csv format and a list of sRNAs matching known miRNAs (in FASTA format). The results table contains a formatted list of reads that match to known miRNAs. It also contains information about redundant (total) and non-redundant (distinct) sequence counts in the input set before and after every filtering step. The csv file can be loaded into any good spreadsheet program.

  • Bruno Costa

    Hello, I have a question concerning a strange result that is happening.

    I have a list of sequences that should be annotated as miR482 and in fact
    when only these sequences are used as input for miRProf they are
    correctly annotated.
    But when this list is appended with another list of sequences they are no longer annotated.

    Is there a simple explanation for this event?

    miRProf parameters
    mismatches=2
    overhangs=true
    group_mismatches=true
    group_organisms=true
    group_variant=true
    group_mature_and_star=false
    only_keep_best=true
    min_length=18
    max_length=26
    min_abundance=1

    mirbase21

    • The sRNA Workbench

      Hi Bruno,

      The answer is not obvious, is the input file large? Could I have a look at both versions? Perhaps you could email them to me if they zip up small enough…

      Cheers,
      Matt

      • Bruno Costa

        Thanks I have sent you an email with all the relevant files in a tar.gz file so you can replicate the problem.

        Most likely it’s something obvious but I have looked at it from various different angles and I haven’t figured it out yet.

        Bruno

      • Bruno Costa

        Hello Mat.

        I have sent the information to your institutional email address. Can you confirm you have received it?

        Best regards,
        Bruno Costa

        • The sRNA Workbench

          Hi Bruno,

          I have ran the data now. The reason you do not get those reads back in the appended file is that there are better matches to miRNAs in your input set when you use the full dataset.

          You ran the program using 2 mismatches but also asked it to only keep the best matches. My assumption is that those sequences align to mir482 with 2 (or 1) mismatches but as there are miRNAs in the file with less mismatches it will only keep those in the eventual results. If you rerun and set that flag to false you will see your mir482 sequences in the results.

          Hope this answers your query please let me know if you have any other questions.

          Best wishes,
          Matt

  • Bruno Costa

    Hello, I have a question concerning a strange result that is happening.

    I have a list of sequences that should be annotated as miR482 and in fact when only these sequences are used as input for miRProf they are correctly annotated.
    But when this list is appended with another list of sequences they are no longer annotated.

    Is there a simple explanation for this event?

    miRProf parameters
    mismatches=2
    overhangs=true
    group_mismatches=true
    group_organisms=true
    group_variant=true
    group_mature_and_star=false
    only_keep_best=true
    min_length=18
    max_length=26
    min_abundance=1

    mirbase21

  • Meng

    Dear Matt,

    I have a question about the result of Mirprof. The results show in the table like mir156a(0), which means precursor of miR156a rather than mature miRNA. So if I would like to know the mature miRNA, then we can’t take the results as mature miRNA? Because if mature miRNA like hsa-miR-486-5p, we can’t distinguish the 5p or 3p from the precursor. maybe I have some misunderstood. So could you give me some help? Thank you very much in advance.

    Best,
    Meng

  • The sRNA Workbench

    Hi Katja,

    It appears as if the output is in decimal so it can output normalised values. I will check why miRProf is not accepting it.

    The output looks like this so Excel will format the file correctly on read (the commas are to push the data to a new column) I am not sure why excel wont read it though. Could you email me a small portion of the CSV file that it wont read so I can have a look? Also if possible a small portion of the input file you gave to miRProf?

    matthew.stocks@uea.ac.uk

    Cheers,
    Matt

  • Sean

    Hello,

    I’m trying to run mirProf. However, after selecting the input and genome file path (using the tutorial data) when I hit start I get the following error message: /Applications/srna-workbenchV2.3.app/Contents/Java/User/temp/_8/mature.fa_plusXXX.fa (No such file or directory). If it helps I initially had some trouble with Java where in the program would not start (I’m using OSX 10.9.4) had to solve the problem by entering the following into the command line “export JAVA_HOME=”/Library/Internet Plug-Ins/JavaAppletPlugin.plugin/Contents/Home”.

    Best,
    Sean

    • The sRNA Workbench

      Hi Sean,

      Just a quick one, the path you mention suggests it is installed into V2.3 but surely you mean 3.2?

      I see you have set java home to use the internet plugin, this may cause an issue, the quickest way I have found to force OSX to configure paths correctly is to install the JDK (not sure why it seems not to work with the JRE for me anyway)

      http://www.oracle.com/technetwork/java/javase/downloads/jdk8-downloads-2133151.html

      Also, if you try this and it still doesn’t work is there anything in the log files you could send to me? (/Contents/Java/user/logs)

      Let me know if this helps,
      Matt

      • Sean

        Hi Matt,

        First, I did mean to type V3.2. Second, I used the link you posted to force OSX to use the JDK. Now when I ask the terminal what version of Java it tells me “java version “1.8.0_20″”. After doing this, initially, I had the same problem, however, after removing and then re-installing the Workbench everything worked fine.

        Thanks for the help,
        Sean

        • The sRNA Workbench

          Hi Sean,

          Ok great stuff, perhaps something got messed up on the first install.

          Let me know if I can help further.

          Best wishes,
          Matt

  • Sarah

    Hiya,

    I hope this isn’t a really stupid question, but for some reason mirProf won’t take the genome files that i’m giving, it just fails. I’m using all non coding RNAs as a reference, and i’ve checked the format of each genome file.

    Am i doing something terribly wrong?

    • The sRNA Workbench

      Hi Sarah,

      Are the genome files publically available? Or could you send them to me via dropbox? Just so I can check out the formatting etc.

      Cheers,
      Matt

      • Sarah

        Heya,

        It’s the publicly available ensemble gh37.75 ncRNA file. I compiled my own miRNA only file and that seems to be working fine!

        Thanks for the super speedy response!

        • The sRNA Workbench

          Hi Sarah,

          Sorry to be a pain, could you provide me a URL link to the file? Were you using the same input small RNAs for both the working and non working fileset?

          Cheers,
          Matt

          • Sarah

            Heya,

            No that’s perfectly fine. You can find it here ftp://ftp.ensembl.org/pub/release-75/fasta/homo_sapiens/ncrna/

            Yes I was using the same inputs for both.

            Thanks again for the help.

          • Sarah

            Any luck?

          • The sRNA Workbench

            Hi Sarah,

            So sorry for the delay in looking into this further. I have been away from the office for an amount of time and I am just getting through my emails etc now.

            I think I see the problem with this file, I just opened it up to have a look and each line looks like this:

            >ENST00000516042 ncrna:snRNA chromosome:GRCh37:21:21728060:21728164:-1 gene:ENSG00000251851 gene_biotype:snRNA transcript_biotype:snRNA
            GTGTTCAAGTAGATAGCATATCTACTAAAACTGGAATAATACAGAAAAGGCTAGCATATA
            CCTGCAAAAAATGGCATGCAAATTTGTGAAGCATTTCATATTTTT

            etc. Note the line feed in the middle of the sequence? This will cause the software to crash as it is only looking for the sequence on one line. Would you like me to fix the file for you and send a new version?

            Best wishes,
            Matt

  • abhinandanmani tripathi

    I’ve successfully used miRProf online for sRNA data previously but now a days i will facing problem and got a error massage

    Error

    A back-end machine is not responding

    There seems to be a problem with the computer cluster that processes the jobs at the moment.
    Please try again in a few minutes and let us know if the problem persists.

    • The sRNA Workbench

      Hi,

      Yes there appears to be a problem with the cluster communication at the moment.

      We do not officially support the web tools any more, Is the downloadable java version suitable for your needs?

      Best wishes,
      Matt

      • abhinandanmani tripathi

        I thank you for your help

  • abhinandan

    i have successfully used online mirproof for small analysis but now a days i got error like

    Error

    A back-end machine is not responding

    There seems to be a problem with the computer cluster that processes the jobs at the moment.
    Please try again in a few minutes and let us know if the problem persists.
    We apologise for the inconvenience.

    • The sRNA Workbench

      Hi,

      Yes there appears to be a problem with the cluster communication at the moment.

      We do not officially support the web tools any more, Is the downloadable java version suitable for your needs?

      Best wishes,
      Matt

  • The sRNA Workbench

    Hi Kate,

    Sorry for the delay in reply, I have been on leave all of last week.

    The example you have shown me looks ok. I would imagine there is something else wrong with the file. If you are happy for me to do so, you can send the file to me and I will try and figure out what is happening.

    Let me know if this is ok with you and we can setup a drop box or similar.

    Cheers,
    Matthew

    • The sRNA Workbench

      To anyone following this issue it has now been resolved and was due to some invalid lines that had been inserted into the input data. Removal of these lines solved the problem.

      I will look at putting some new error checking in to give a more informative message if the software detects such a problem with input data again

  • Nitin

    Hi Matt, I ran mirprof with the following command:
    java -jar Workbench.jar -tool mirprof –mirbase_db Zea_mays_mature_miRNA2.fa –out_file test.out -genome ZmB73_RefGen_v2.fasta –srna_file_list
    NG-6873_RIL125_lib28458_1796_6_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa,NG-6873_RIL95_lib28435_1777_7_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa,NG-6873_RIL96_lib28436_1777_7_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa,NG6873_RIL99_lib28437_1777_7_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa

    It ran without any error, however it only gave me only these two files:

    profile.csv:

    “miRProf results”

    “Normalised count: count of matching sequence reads normalised to total number of reads after last filtering step (see table below). Given in parts per million”

    “miRBase database: Zea_mays_mature_miRNA2.fa, number of allowed mismatches: 0”

    “Mismatch filtering: keep best matches only”

    “Grouping options used: ignore mismatches, combine organisms, combine variants”

    “Sample filenames”

    0,NG-6873_RIL125_lib28458_1796_6_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa

    1,NG-6873_RIL95_lib28435_1777_7_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa

    2,NG-6873_RIL96_lib28436_1777_7_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa

    3,NG-6873_RIL99_lib28437_1777_7_1.noAdptr.len_filtrd.no_rRNA_tRNA.fa

    “Read counts”

    ,0_total,0_distinct,1_total,1_distinct,2_total,2_distinct,3_total,3_distinct

    “input”,3598975,1324817,8371423,2243773,11712245,1054904,10498315,1673797

    “filter by sequence length”,2603226,1021045,6185709,1672671,10733830,829411,7912153,1226987

    “filter low-complexity sequences”,2603195,1021020,6185658,1672628,10733814,829395,7912111,1226954

    “filter by min-abundance and max-abundance”,2603195,1021020,6185658,1672628,10733814,829395,7912111,1226954

    “filter invalid sequences”,2603195,1021020,6185658,1672628,10733814,829395,7912111,1226954

    “filter by genome (matches in)”,1561672,724998,2953454,1224618,1371812,644920,2109805,876912

    And
    srnas.fa:

    >all combined-mir156_1_Abundance(60)

    TGACAGAAGAGAGTGAGCAC

    >all combined-mir156_2_Abundance(5)

    GCTCACTTCTCTTTCTGTCAGC

    >all combined-mir156_3_Abundance(3)

    TGACAGAAGAGAGTGAGCA

    >all combined-mir156_4_Abundance(1)

    TGACAGAAGAGAGCGAGCAC

    >all combined-mir156_5_Abundance(1)

    GCTCACTTCTCTTTCTGTCAG

    ……. etc

    I was hoping to see a multi column file with the count of each srna in each of the 4 samples. Can mirprof generate that?

    Thanks,
    Nitin

    • The sRNA Workbench

      Hi Nitin,

      Which version of the software were you using, miRProf does supply this information in the output but a bug in Version 3 was preventing it from outputting the data to CSV. This should be resolved in Version 3.1 however. Have you downloaded the latest code?

      Best wishes,
      Matt

  • Alice Lunardon

    Hi Matt,
    I tried to use miRProf in a linux server I have now on my lab: the tool works correctly, the only problem I encountered is when I save my results in .csv format. I explain: inside the tool i see correct number of raw and normalized abundances but when I save the data in the .csv file here I lose all decimal numbers and decimals numbers are splitted in two columns. I did not manage to solve the problem by opening the file in excel because in the .csv file both comma and points are saved as commas, for example a normalized abundance 2.16 is saved in the .csv file as 2,16. I don’t it is a problem of my computer settings, because I tried several settings and I obtain always the same result.

    I thank you for your help!

    Alice

    • Hi Alice,

      How are you logging into the Linux server? Is it through a terminal from a windows machine? Is the linux machine setup to be English or Italian? The problem is CSV files are comma separated values which of course poses a problem if values themselves are also separated with commas! Currently, the software must be run on a machine configured as English (UK or US) for it to format numbers with a decimal point instead of a comma which doesnt really help you at the moment!

      A quick solution would be to drop down all the miRNAs from the result table and simply highlight and copy paste the data into an excel spread sheet (which is a bit of work I am afraid if there are lots of miRNAs in your results). In fact the miRProf exporter is not working correctly at the moment anyway in terms of how it groups miRNAs (one column is missing, it is a known bug and will be fixed in the next release). As this is going to be a problem for anyone using a European format I will also add it to the fixes and look at including the option to output the results to TSV (tab separated values) or if possible an XML based exporter so I can directly create excel files.

      Sorry I cannot be of any more help, I will step up the release schedule and try and get this available as soon as possible.

      Best wishes,
      Matt

      • Alice Lunardon

        Hi Matt,
        I am logging through a terminal and my pc is set to English but still don’t manage to get the the correct results, don’t know why..thank you anyway!

        Alice

  • Hi Alice,

    yes it is output row by row, since redesigning I need to simply add the missing column in the table but the order remains the same πŸ™‚ it is a simple fix but I usually try and wait until I have several new features/fixes before releasing new code to reduce the amount of downloading people have to do (unless it is a real game breaker)

    For the command line, you must provide a text file containing the parameters you wish to use. Examples for these (you can just copy paste and then edit in any text editor) can be found in data/default_params

    If you need to access the help just type … -tool mirprof and the message should appear

    You will find example files for all tools, if you copy the default_mirprof_params.cfg into a new location and modify it you could expect your command to look something like

    java -jar Workbench.jar -tool mirprof -srna_file_list 118372.fa -mirbase_db /sRNAWorkbench/Workbench/dist/data/mirbase/19/mature.fa -out_file result2.csv -genome TAIR10_chr_all.fas -params default_mirprof_params.cfg

    where is the path to your install. A few things though, the csv file is currently suffering even worse from this bug and has none of the information contained from the GUI, you will get the fasta file of all the miRNA sequences though.

    In addition, if you are running many small RNA files through miRProf you may need to increase the RAM from the default amount. Usually this is done for you with the sRNAWorkbenchStartup.jar but to run from the CLI you must bypass this program and therefore need to do this yourself. Let me know if you need instructions on how to do this.

    Please expect a fix for the output as soon as possible πŸ™‚

    • Alice Lunardon

      Hi Matt,
      I found a strategy to recover only the matches of one species by replacing the the file with mature mirna with one containing only mine of interest πŸ™‚
      With the command chmod 777 I think now all the executables and the workbench have full read/write access, but I still am not able to find the help message πŸ™ I tried by typing:
      java -jar Workbench.jar -tool mirprof
      Workbench.jar -tool mirprof
      -tool mirprof
      (also with the entire path to the directory where the Workbench.jar is) I really can’t understand with is wrong with it!
      To eventually increase the memory I think I have to type:
      java -jar -Xmx10G /path/../srna-workbenchV2.5.0/Workbench.jar … is it right?

      Thanks a lot!!

      Alice

      • hmm a very strange one, I have no idea why you are not receiving the help message. I just tried java -jar Workbench.jar -tool mirprof from inside the workbench directory and got back:

        Error: The parameter srna_file_list must be specified.
        Usage:
        java -jar /path/to/Workbench.jar [-verbose] -tool mirprof [-f] -srna_file_list comma-seperated-srna-file-paths -mirbase_db mirbase-file-path -out_file output-file-path [ -params params-file-path ]
        -f = Force overwriting of output file

        which is the correct help message. If you just type java -jar Workbench.jar -tool do you get any of the other help back? if you leave the -tool does the workbench boot into GUI mode?

        Yes you are nearly correct with your -Xmx but prefix with -Xms10g so:

        java -Xms10g -Xmx10g -jar Workbench.jar -tool ….

  • Alice

    Hi,
    I am using miRProof from (2.5.0) in a linux cluster; I started the analysis but while the program is matching the sRNA data to the genome it is killed with Error I message. This is what I have in my prompt:
    Mar 20, 2013 12:48:12 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: MIRPROF: Message: 1;
    Stack Trace: uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanEntry.parse(PatmanEntry.java:185)
    uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanReader.process(PatmanReader.java:78)
    uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanReader.process(PatmanReader.java:42)
    uk.ac.uea.cmp.srnaworkbench.tools.mirprof.Mirprof.process(Mirprof.java:211)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    java.lang.Thread.run(Thread.java:662)

    Could you please help me on understanding the problem?

    Thank you

    Alice

    • Hi Alice,

      Are you able to run the program without supplying the genome file? In addition, are you able to align the sRNA data to the genome through the sequence alignment tool?

      In addition, are you running in GUI mode with X-Window or from the CLI?

      Thanks,
      Matt

      • Alice Lunardon

        Hi Matt,
        I performed the alignment separately and than I run the program without matching to the genome and it works, thanks a lot!
        I use a GUI mode with -X in a linux cluster.

        I run the program without grouping for the organisms: I obtained the right results in the interface but when I download the csv file I loose the information of the different organism, is there a way to save the results divided per organism?

        Many thanks

        Alice

        • Ok great, I must look into now why the alignment did not work however because this will have an affect on normalised values for the sequence abundance!

          Can you confirm that the directory for the workbench has full read/write access, also that the patman binary (ExeFiles/linux) has execute permissions?

      • Alice Lunardon

        Hi Matt,
        I checked the .csv file and I see that the counts are divided per organism but I don’t have the name of organisms, why don’t I recover the name of the species?

        Thank you

        Alice

        • Hi Alice,

          Yes there is a few issues with the output to CSV at the moment that a couple of users have reported. I changed quite a lot with the updates to miRProf in the last release but obviously missed something in the output modules. I am working on a fix for it now so that the CSV files completely reflects what is shown in the GUI. I will release the fixed version as soon as possible. You may be able to simply copy paste the entire table into EXCEL (I havent tried this) Bear with me on the fix πŸ™‚

          Cheers,
          Matt

          • Alice Lunardon

            Hi Matt,
            can I assume that the species in the .csv file are in the same order than in the interface? I need Zea maize, in this way I could know that it’s the last of the list, although it’s name it is not written.
            (I will also try to copy and paste form the interface)

            If I want to run the program from the command line what is the command to type to see the manual, in particular to see how to write the parameters? I tried with java -jar Workbench.jar -tool mirprof –help but it does not work.

            Thank you very much!

            Alie

          • Hi Alice, please see reply above as the text became very squashed and unreadable!

  • Kenlee Nakasugi

    Hi Matt,
    I just started using the latest version 2.5 of Workbench.jar, in Linux Ubuntu using java -Xmx10g -jar Workbench.jar.
    I ran miRProf off this, without grouping organisms, using miRBase19 and plant only matures. When I saved the output to csv, there are no indicators in the export file as to which miRNAs belong to which organism, although this is shown in the GUI. The row order of the miRNAs in the csv do appear to coincide with that of the GUI, just missing the organism names to separate them. Is this expected?
    Also as a feature request, would it be possible to save the miRBase version and category details in the ‘save parameters to disk’ option?

    cheers,
    Ken

    • Hi Ken,

      I hadn’t noticed, but I will fix this for the next version. Thanks for pointing it out! Also, yes your feature request is fairly simple and I will also include it in the next version πŸ™‚

      Thanks again,
      Matt

  • Nathaniel Street

    Would it be possible to also include the ability to use output from miRCat as an addition to the use of miRBase? It would be cool to predict de novo miRNAs and then use miRProf to generate expression values for those de novo predictions.

    • Hi Nathaniel,

      could you give a little more information about what you mean? Are you thinking something along the lines of outputting normalised expression levels for the miRNAs predicted over a range of samples? Then collating these into a spread sheet?

      • Nathaniel Street

        That’s exactly what I’m thinking. I would like to have normalised expression values for the miRNAs predicted by miRCat using the same normalisation calculation as in miRProf. I can generate that by mapping all of the reads back to the predicted miRNAs but it would be great if one of the tools could include this option.

        • Hi Nathaniel,

          Ok no problem, you will notice I just released a version of the program (hence the delay on replies etc while I was locked in a cupboard with my laptop) with some pretty major changes to the output miRProf produces (hopefully this will make the tool much more usable). Unfortunately this feature is not included in this release, however, although the release notes are quite long this is really just a pre-cursor for a much larger release in the next few weeks.

          I have started on the code for this today, and will introduce a normalised calculation into miRCat and try and devise some kind of usable output for the major release (along with the SAM/BAM format if possible)

          Thanks again for the suggestion πŸ™‚ this is exactly the sort of thing that helps me improve this program.

          Best wishes,
          Matt

  • Gracie

    Hi,

    I am using miRProf in sRNA Workbench 2.4.0 (release11), miRBase is latest version 18.
    I don’t get a parameter window either. After uploading the sRNA and reference, staring the miRProf gives me an error “String index out of range: -17”.
    Could you please drop a hint why this is?

    Thanks!
    Gracie

    • Hi Gracie,

      Sorry for the delay, I tried to email you yesterday to gather some further information but my email got bounced for some reason. If possible could you email me at matthew.stocks@uea.ac.uk so I can gather some further information privately?

      Best Wishes,
      Matt

    • Gabrielle

      What was the answer with the string index out of range problem?
      I have the same version I believe and mine says it has “string index out of range: -5”

      Any clues would be great!
      Thanks,
      Gabrielle

      • Hi Gabrielle,

        The problem was related to the input data not being in non-redundant format. Many of our tools produce a non-redundant format and the others require this format to work. If you run your data set through the filter tool and ensure the “make output non-redundant” is checked this may solve your problem.

        Please let me know if this helps or if you need further explanation.

        Best wishes,
        Matt

  • Chintan Vora

    I am not getting parameter window of mirprof in version 2.2 and how does it update the mirbase as i am not able to update the mirbase also.Please help me out with this.

    • admin

      Hi,

      RE your problem with miRBase (copied from another response)

      you may be experiencing an issue related to Java 1.7 when attempting to download/update miRBase files (related to support for IPv4, Java are aware of the problem but I am not sure when their updated code will be available). We are attempting to add a work-around at the moment.

      The software should work fine on Java 1.6 (any update). If you want instruction on how to use an earlier version of Java please let me know.

      As for the parameter window, I am not sure why this would happen, I have not experienced a case where it didn’t appear. Did you try to press the “Show Parameter Browser” button on the tools drop down menu? miRProf does not show the parameter browser by default.

A suite of tools for analysing micro RNA and other small RNA data from High-Throughput Sequencing devices