banner2_1038X692

miRCat

Available from Version: 1.0

miRNAs are a well-studied class of sRNAs that are generated from a single-stranded RNA (ssRNA) that forms a stable, partially double stranded stem-loop structure (hairpin). miRCat predicts miRNAs from high- throughput sRNA sequencing data without requiring a putative precursor sequence as these will be identified by the program.

miRCat projects are created by entering the new project menu which is found under the file menu.

Once the sequences are mapped to the input genome, miRCat will look for genomic regions covered with sRNAs (sRNA loci), containing reads with abundance at least five (this threshold can be adjusted using the min abundance parameter).

These loci must match certain criteria:

  1. Loci must contain no more than four non-overlapping sRNAs.
  2. Each sRNA in a locus must be no more than 200nt away from its closest neighbour (this threshold can be adjusted using the –hit dist parameter).
  3. At least 90% of sRNAs in a locus must have the same orientation (this threshold can be adjusted using the –percent orientation parameter).

Once a list of loci has been produced, it is further analysed in order to find likely miRNA candidates:

  1. The most abundant sRNA read within a locus is chosen as the likely miRNA.
  2. Flanking sequences surrounding this sRNA are extracted from the genome using varying window lengths.
  3. Each sequence window is then folded using RNAfold, producing a secondary structure for the putative miRNA that can then be viewed using the Hairpin Annotation Tool
  4. miRCat then trims the secondary structure and computes discriminative features useful for classifying miRNAs. The features are:
    • The number of consecutive mismatches between miRNA and miRNA* must be no more than 3.
    • The number of paired nucleotides between the miRNA and the miRNA* must be at least 17 of the 25 nucleotides centred around the miRNA.
    • The hairpin must be at least 75nt (for plants) or 50nt (for animals) in length.
    • The percentage of paired bases in the hairpin must be at least 50% of base-pairs in the hairpin (this threshold can be adjusted using the –max percent unpaired parameter).
  5. The hairpin with the lowest adjusted minimum free energy (AMFE) from the sequence windows is then chosen as the precursor miRNA (pre-miRNA) candidate
  6. The pre-miRNA candidate is then tested using randfold using a AMFE cutoff.
Hairpin for miR164
Hairpin Annotation Tool output showing miR164 precursor.

Parameters:

  • genomehits: The maximum number of genome hits. (1 > genomehits, default genomehits = 16).
  • hit dist: The maximum distance between consecutive hits on the genome. (hit dist, default hit dist = 200).
  • max gaps: The maximum number of consecutive unpaired bases in miRNA region. (0 > max gaps < 5, default max gaps = 3).
  • max overlap percentage: The maximum total percentage of miRNAs that lie under the miRNA or miRNA* position on the hairpin. (30 < max overlap length, default = 70).
  • max percent unpaired: The maximum percentage of unpaired bases in hairpin. (1 < max percent unpaired < 100, default max percent unpaired = 50).
  • max unique hits: The Maximum number of non-overlapping hits in a locus. (1 < max unique hits, default max unique hits = 3).
  • maxsize: The maximum length of a miRNA. (18 < maxsize < 24, default maxsize = 22).
  • min abundance: The minimum sRNA abundance. (1 < min abundance, default min abundance = 5).
  • min energy: The adjusted minimum free energy of the hairpin. Must be < 0. Default = -25.
  • min gc: The Minimum percentage of G/C in miRNA (must be > 1 and < 100. Default = 10).
  • min hairpin length: The minimum length of hairpin (nt) (must be > 50. Default = 75).
  • min paired: The Minimum number of paired bases in miRNA region (Must be > 10 and < 25. Default = 17).
  • minsize: The Minimum sRNA size (Must be > 18 and < 36. Default = 20).
  • Allowing complex loops: This will allow or remove any hairpins containing complex loops.
  • Orientation percentage: The percentage of sRNAs in locus that must be in the same orientation (1 < percent orientation < 100, default percent orientation = 90).
  • Hairpin Extension: How much each hairpin should extend past the sRNA read to form the window (40 < window length < 400, default window length = 150).

During the analysis procedure the results are entered into the table as shown below:

The table contains the following information:

  • Chromosome
  • Start position
  • End position
  • Strand/orientation
  • Abundance (number of times sequenced in high-throughput dataset)
  • Sequence of predicted mature miRNA
  • Representative sequence accession from input dataset
  • Length of predicted mature miRNA
  • Number of matches to genome
  • Length of predicted precursor hairpin sequence
  • G/C % content of hairpin sequence
  • Minimum free energy (MFE) of predicted hairpin sequence
  • Adjusted MFE, AMFE = (MFE / length of hairpin) * 100
  • Shows MFE per 100nt making results comparable
  • miRNA* shows predicted miRNA* sequence(s), if any, along with abundance in input dataset shown in brackets
  • Hairpin Sequence (with miRNA sequence highlighted in blue and miRNA* if present in red)
  • Hairpin Dot-Bracket notation
  • Hairpin start position
  • Hairpin end position
  • miRNA* start position, if present
  • miRNA* end position, if present

A user has the option to interact with the results in real time in several aspects. Using the Export menu a user can export the results to file. A user can also use the controls shown at the top to output the results as they are generated to file or pipe all results into into either the RNA Folding/Annotation tool or the VisSR tool.

The miRCat toolbar

Additionally a context menu has been included to allow the user to pipe a single result line into two other tools in the sRNA Workbench.

The miRCat context menu

Both options operate on the currently selected result line. ‘Render Hairpin’ will render the selection in the Hairpin Annotation tool, while ‘Show in VisSR’ will display the selection in VisSR.

The image below shows the VisSR output of a single miRNA classified in mircat:

VisSR showing miRNA 165 after being classified with miRCat
  • Swetha

    Hi there,

    I have ran miRCat and the status says that it has ran successfully but, I get no hits in the result panel (picture attached). But it worked properly and gave results for the same datasets a year ago. The terminal from where I launched the workbench shows up the warning “WARNING: MIRCAT: reached window 14 and all checks failed so ignoring”. What does it exactly mean and how can I trouble shoot it? Thanks in Advance.

    • Meng

      Hi Swetha,

      I have the same problem with you, did you solve it?

      Best,
      Meng

  • The sRNA Workbench

    Hi Kavitha,

    Could you try shutting down the software, ensuring there are no other java processes running at all then restarting and see if you get the same problem?

    Cheers,
    Matt

  • The sRNA Workbench

    Hi Paul,

    Some organisms require more RAM (mostly plants due to the extra complexity in sRNAs) it is hard to say exactly how much will be required.

    You could try and force more RAM into the program using these steps:

    1. be sure no other RAM hungry applications are running
    2. start the workbench directly rather than using the startup program by going into the OSX package and the java folder in the terminal, when you are inside the directory type:

    java -Xms6g -Xmx6g -jar Workbench.jar

    To give (for example) 6GB of heap to the workbench to work with. I cannot say for definite that this will be enough though!

    Let me know if you need any further help with this or if it works for you

    Best wishes,
    Matt

  • The sRNA Workbench

    Hi Dai,

    The results will be placed in a folder called output in your install directory, the next version of the software will allow users to ask for the output to be placed in another location however.

    Cheers,
    Matt

  • The sRNA Workbench

    Hi Pedro,

    Could you let me know which java version you have installed?

    Cheers,
    Matt

  • The sRNA Workbench

    Hi Lucas,

    Sorry for the delay in response, I have not tested on that OS yet but it certainly seems to be a problem with those binaries, possibly related to a new version of ubuntu (quite hard to keep up to date with them all as I mainly work alone!)

    If you try to execute them directly from the shell do they run?

    Cheers,
    Matt

  • Hi Matthew,

    I have some probelm mirCat,

    I have uploaded sRNA file and and reference file to mirCat.In both file read contain T.
    mirCat is working with fine these file.But when I changed T to U in read , there is no out put from mirCat. So please let me know how to solve these problem ..?

    Thanks ,

    Shameem.y

  • Mayur Divate

    Hi Matthew,

    I have a simple question.

    How do you calculate p-value in miRCat ?
    And what exactly it indicates ?

    Thank You !

    • The sRNA Workbench

      Hi Mayur,

      The p-value is calculated using the randfold software package (further details can be found here)

      http://bioinformatics.psb.ugent.be/software/details/Randfold

      Essentially it computes the probability that the MFE of our predicted precursor sequence is different from a certain number of random precursors (100).

      I hope this helps, let me know if you need further info,

      Cheers,
      Matt

      • Chirag Parsania

        Hi Matt,

        Does that mean lower the p-value better the result ?

        Cheers
        Chirag

        • The sRNA Workbench

          Hi Chirag,

          once again sorry for the delay in response here, the UEA has been closed over the Easter period.

          Yes low p-values would tell us that the MFE value of original structure of the predicted precursor is significantly different from that of a random sequence (highly unlikely that the sequence structure appears by chance)

          Cheers,
          Matt

          • Nitin

            Hi Matt,

            I am using miRCat for known and novel miRNA prediction. When I am using its GUI version, I need to give genome file, sRNA file and by default it will take mirbase also. I am getting known and novel miRNAs. But when I am using it command line there is no option to give mirbase and I am getting all the novel miRNAs.

            java -Xmx20g -jar Workbench.jar -tool mircat -srna_file smallrna.fa -genome hg19.fa -params default_mircat_params.cfg

            Can you please help me how can I provide mirbase database command line too.

            Thank you

            Regards

            Nitin

          • The sRNA Workbench

            Hi Nitin,

            It should just use them if they are there, are the miRBase files present and in the correct location on the CLI run?

            Cheers,
            Matt

          • Nitin

            Hi Matt,

            Yes; those files are there (srna-workbenchV3.2/srna-workbench/data/mirbase/21)

            Command used: java -Xmx20g -jar Workbench.jar -tool mircat -srna_file srna.fa -genome hg19.fa -param default_mircat_params.cfg

            I am running the command from : srna-workbenchV3.2/srna-workbench/ directory

            Thank you

            Regards
            Nitin

          • The sRNA Workbench

            Hi Nitin,

            Perhaps it is not reported in the CLI version. I have some other missing features in the CLI version output to add anyway. I will look into it…

            Cheers,
            Matt

          • Nitin

            Hi Matt,

            I am running miRCat with GUI version. With java -Xmx1024m -Xmx1024m -jar Workbench.jar

            I tried it with:

            java -Xmx3g -Xmx3g -jar Workbench.jar
            java -Xmx4g -Xmx4g -jar Workbench.jar

            Still out of memory error is coming. Please help me how I should solve this. I have a 4 GB RAM system.

            Thank you

            Regards

            Nitin

          • The sRNA Workbench

            Hi Nitin,

            It is possible the dataset is just too large to be processed with only 4GB of RAM. There is a new version of miRCat out shortly that will allow much larger datasets to be processed (at the cost of run time speed).

            I will be placing this version online before christmas after the testing is complete.

            Cheers,
            Matt

  • Dhananjay Kumar

    Hello Matt

    Thanks for response, I am trying to do as you suggested.

  • Dhananjay Kumar

    Dear Matthew,
    I am using miRCat, miRProof online server but their is no reference genome sequence of wheat (Triticum aestivum). Can you please upload Wheat draft genome sequence or Wheat Unigene sequence or Wheat ESTs.

    • The sRNA Workbench

      Hi Dhananjay,

      I will try and get something uploaded for you shortly but the new cluster has some limits that I must adhere too so watch this space…

      However, is the workbench version of the tools not suitable for your needs?

      Cheers,
      Matt

  • The sRNA Workbench

    Hi Bala,

    Sorry for the delay in reply, I have been on leave all of last week.

    Are you setting miRCat to use 5000 threads through the GUI option? If so that is unlikely to work. You should never set more heavy weight processing threads than the number of physical processing units you have available.

    For example, if you have 8 cores, you should set 7 threads (leave one free for other things).

    The error you are receiving is because the software is trying to open 5000 sockets for communication with the external binary programs and this is not possible.

    The default amount you find in the box is usually one less than the total amount of cores on your machine.

    I hope this helps, please let me know if you have any further questions

    Cheers,
    Matthew

  • The sRNA Workbench

    Hi Bala,

    Sorry for the delay in reply, I have been on leave all of last week.

    Are you setting miRCat to use 5000 threads through the GUI option? If so that is unlikely to work. You should never set more heavy weight processing threads than the number of physical processing units you have available.

    For example, if you have 8 cores, you should set 7 threads (leave one free for other things).

    The error you are receiving is because the software is trying to open 5000 sockets for communication with the external binary programs and this is not possible.

    The default amount you find in the box is usually one less than the total amount of cores on your machine.

    I hope this helps, please let me know if you have any further questions

    Cheers,
    Matthew

  • The sRNA Workbench

    Hi Cankut,

    Sorry for the delay in reply, I have been on leave all of last week.

    It is possible that the software predicted more than one possible hairpin structure and reported only the one with the lowest minimum free energy back to you.

    I will check it out and get back to you. Do you have a publicly available example I can use for testing?

    Cheers,
    Matt

  • The sRNA Workbench

    Hi Cankut,

    Sorry for the delay in reply, I have been on leave all of last week.

    It is possible that the software predicted more than one possible hairpin structure and reported only the one with the lowest minimum free energy back to you.

    I will check it out and get back to you. Do you have a publicly available example I can use for testing?

    Cheers,
    Matt

  • bala

    Hi Matt,
    I am always getting the error message “No buffer space available (maximum conncetions reached ?): connect ” when I am running the workbench with big files (small RNA reads about 2-3 million reads) files. It is actually doing fine with aligning and loading the genome and categorizing the miRNA list and also some threads execution part. For example if it finds 5000 threads it is doing fine and give the results upto 3500 threads but after that its suddenly stop doing the execution and numbers down very rapidly and finally giving the above error message. Of course, I thought it would be RAM memory problem but its not that because I tried to run in 16 GB RAM computer with same file but the problem is still there and I check memory used by the programme and its just about 8 GB in 16 GB ram computer. So what could be the problem and I really want to run the big files because dividing the about 13 million reads file into 100000 sRNA reads for each file and run that every file is not a good idea. Also, when I am doing with small files the same results are repeating may be the same small RNA reads present in different files

    • The sRNA Workbench

      Hi Bala,

      Sorry for the delay in reply, I have been on leave all of last week.

      Are you setting miRCat to use 5000 threads through the GUI option? If so that is unlikely to work. You should never set more heavy weight processing threads than the number of physical processing units you have available.

      For example, if you have 8 cores, you should set 7 threads (leave one free for other things).

      The error you are receiving is because the software is trying to open 5000 sockets for communication with the external binary programs and this is not possible.

      The default amount you find in the box is usually one less than the total amount of cores on your machine.

      I hope this helps, please let me know if you have any further questions

      Cheers,
      Matthew

      • bala

        Hi Matt,
        how large files can we run in workbench. Is there any limit to run????

        • The sRNA Workbench

          Hi Bala,

          Unlike the web implementation the filesize limits are dependent on your hardware only. Currently the program requires fairly large amounts of RAM to run large datasets but I am working on reducing this for an upcoming version.

          The next beta release for example has a reduced memory version of the Adapter Removal tool which will serve as a test for the reduced memory versions for all tools.

          Cheers,
          Matt

          • bala

            Hi Matt,
            That’s great news. Could you tell me approximately how much memory does it need to run a 400 Mb Reference genome file and 170 Mb small RNA data file.

          • The sRNA Workbench

            It is tricky to determine total memory amounts because the data can vary so dramatically. In my experience so far for example, animal data uses far less memory than plant data and I hypothesise this is because animal small RNAs are far less varied.

            I would just allow the program as much RAM as you can and then see how it goes. Are you using the startup program or firing the workbench directly from the Workbench.jar file?

          • bala

            I use both and also XMX command but all of them doesn’t work for big files so far. I am doing with plant version. If RAM is the problem I have alternative to run the programme with large memory computer but before that I need to be sure that error persists because of unsuffiecient memory

          • The sRNA Workbench

            yes that might be necessary, just to be clear you apply the -Xmx -Xms commands to the Workbench.jar program rather than the startup.

            It is the main problem I am looking into solving now for an upcoming version of the bench. The next release will see the first low memory version of the tools (Adapter Removal) and then I will roll the others out periodically.

            You can also modify some of the parameters in miRCat to use only more abundant sequences or filter the data to remove contamination such as t/r RNAs out of the dataset to reduce the filesize

          • gracie

            how do you define this “fairly large amounts of RAM”? πŸ˜‰

          • The sRNA Workbench

            Hi,

            Well, I have ran through quite large (>6GB) zebra fish files in just a few GBs and far smaller tomato data required 10 times the amount of RAM. It is difficult to define because the amount of memory required is purely dependent on the input data.

            In general plant data takes more RAM than animal data and I hypothesise that this is because of the greater diversity in plant small RNAs. Overall, miRCat is the most computationally expensive tool in the workbench at the moment.

            The new low memory Adapter Removal tool will hopefully be uploaded today, if all goes well then this will be a good template for the update to miRCat and that should drastically reduce the required RAM for any type of input.

            Cheers,
            Matt

  • Chirag Parsania

    Hi Matt,

    I want to predict the knwon miRNA from “XYZ” genome. But I don’t have sequenced reads of small RNA. So I am planing to predict known miRNA from “XYZ” genome using miRbase. Is this possible using miRCat?

    Thanks.

    • pooja sethiya

      Hi Chirag,

      You can.
      Instead of using reads for the “Specify sRNA file” option in miRCAT, upload fasta file of known miRNAs from mirBASE.

      This might help you.

      • The sRNA Workbench

        Hi,

        This is interesting, please let me know if you get some good results with Pooja’s technique!

        Best wishes,
        Matt

  • Ram

    Hell There,
    I have 25 base pair end (50bp) sequences instead of one end 50 bp sequences, is there any way of analysing this kind of data using the UEA Small RNA workbench

    • The sRNA Workbench

      Hi,

      Did you mean paired end reads? If so 25BP might be a little short, I thought usually paired end reads are 50nt from each end?

      Cheers,
      Matt

  • Dinesh Heisnam

    Hi Matt,

    I have a query. we are trying to predict microRNA with miRCat. However genome information not even EST information is not available for the the plant system we are in although we sequence small RNA. So we generate 100X100 paired end genome sequence in arounf 10X coverage and assemble it. But maximum of the scafolds (98%) are ~200bp long. we tried to predict microRNA from this information, but

    we are are not sure about the value of “hit dist” we should give to extract maximum information from this data.
    plz suggest.

    • The sRNA Workbench

      Hi Dinesh,

      It is hard to say, usually for plants we suggest that this value should be around 200nt. However, that will probably cause issues due to the size of your scaffolds.

      This value will be used to construct a locus of which the sequence with the highest abundance will be used as the putative miRNA so if you make this value lower all you will get is far shorter loci, this might not be too much of a problem (it will certainly increase the run-time etc!) and the results might not be as accurate, animal data is often a 50nt separation so you could try that.

      My only thought is to just try a few values out and discover at what range you begin to see some meaningful data.

      I am sorry I cannot be much more help than this. Soon I hope to include a far more advanced technique for building loci (CoLIde) in miRCat and this might serve to alleviate such issues.

      If you do manage to find something that works, could you please post it here so that others may learn from it?

      Best wishes,
      Matt

      • Dinesh Heisnam

        we tried with 50 and it increases the number of miRNA predictions to 3 fold. we are trying with more values now and i will let you know.
        i have another question. we are predicting miRNA from short read reference sequence. in one instance a sequence map towards 5′ end of the ref sequence and it fell short of 100 bp flanking length. my question is how the algorithm take care of such situations.
        whether we need to change the value of the flanking sequence length.

        • The sRNA Workbench

          Hi Dinesh,

          Thanks for letting me know!

          In terms of the extend value, miRCat will try an amount around this +- a certain % as well as the full value. So for example if the extend was 10 (for example) it would take the sequence genome start and end position +-10 then some windows around that region (+20%-180%, +180%-20% etc etc) and attempt to fold these regions as the first step toward classifying a putative miRNA, then continue through the algorithm.

          Let me know if this helps,
          Matt

          • Dinesh Heisnam

            thanks Matt.
            we are expecting the same from your algorithm. this implies that 100 is the maximum value not the minimum. so we need not to play around this value.
            thanks again for the reply. i will keep on posting if i have any further query.

          • The sRNA Workbench

            Yes I see what you mean! I will update the tool tip in the next release (coming soon) to make it a little clearer exactly what this value is doing πŸ™‚ Thanks for the update

  • Ganesh

    Hi Matt,
    I have observed that if you run miRCat for a number of times for the same dataset, you get different number of results each time. Any idea why?

    • The sRNA Workbench

      Hi, sorry for the delay in response I have been away at the start of the week.

      It is not something I have observed before, was it using the data you sent me? I will try and re-create the problem!

      • Ganesh

        Hi Matt,
        Yes it is the same data which I had sent you. When I ran miRCat a number of times and saved the results in .csv format using the “export results to csv” function and then opened the .csv file in MS Excel, each of the file had the total number of results between 97-100.

        • The sRNA Workbench

          Hi Ganesh,

          I have just ran the data 5 times and got the same result each time (100 sequences). How many times did you need to run before the anomaly occurred? Is there any way the export could’ve happened before the software had completely finished? (you can still interact with the data before all sequences have been analysed) or could the parameters have been modified at all between runs? Was the tool shut down before each run or did you begin from the same instance of miRCat?

          Cheers,
          Matt

          Cheers,
          Matt

          • Ganesh

            Hi Matt,
            The anomaly occured when I ran miRCat the 2nd time. Finally I ran it for a total of 5 times. Of them, I got 96 and 99 sequences in 2 results each and 98 sequences in 1 result (by excluding the first header line in the excel file). I will mail you all the 5 excel files. Also, I did the export only after I saw the status as “completed successfully”. I didn’t interact with or modified the data in anyway and I ran miRCat each time with default plant parameters. Neither did I subject the sRNA file to adapter removal or filter tool options. I did close the miRCat application each time after saving the results in .csv file and before opening it again.

          • The sRNA Workbench

            Hi Ganesh,

            I have tried unsuccessfully to recreate the bug using OSX, every time I run with that data I get the same result! Which is very strange. Could I have a little more info on the system you are running on?

            Cheers,
            Matt

          • Ganesh

            I am using the Windows 7 OS

  • Ganesh

    Hi Matt,
    I ran miRCat many times and getting an error “For the input string: TCGGACCAGGCTTCATTCCCGT(3)”. Can you help?

    • The sRNA Workbench

      Hi Ganesh,

      Difficult to say what caused that. Can I have a look at the input data? I will attempt to recreate the error on my computer. You can send it to me via email or we can setup some kind of file transfer if that helps?

      Cheers,
      Matt

      • Ganesh

        I am trying to predict the miRNA sequences from the chickpea genome which can downloaded from this webpage http://www.icrisat.org/gt-bt/ICGGC/GenomeManuscript.htm. Just go to the link on the sentence “Click here to download “Assembly and annotation data” for Chickpea genome”. I will attach my sRNA sequence file along with the mail. Thanks!

      • Ganesh

        As a part of an exercise, I am trying to predict the miRNA sequences from the chickpea genome
        which can downloaded from this webpage
        http://www.icrisat.org/gt-bt/ICGGC/GenomeManuscript.htm. Just go to the
        link on the sentence “Click here to download “Assembly and annotation data” for Chickpea genome” and you will get the genomic file. I will attach my sRNA sequence file along with the mail. Thanks!

        • The sRNA Workbench

          Ok great! You can email me at matthew.stocks@uea.ac.uk I will get back to you as soon as I see the error appear and try to figure out what caused it πŸ™‚

          • Ganesh

            I have mailed you the sRNA file at matthew.stocks@uea.ac.uk.
            Thanks! πŸ™‚

          • The sRNA Workbench

            Ok great, I will have a look at that this morning and get back to you ASAP

          • The sRNA Workbench

            For anyone wondering, we solved this problem by removing tab characters from the FASTA header of the genome file. The workbench cannot presently handle this as it uses tabs to delimit aligned data files.

  • Marius Snyman

    Hi Matt,

    I executed a mirCat run twice now but everytime I get an error message saying “Index:35, Size:35”. This causes the run to fail. Can you lend me some help?

    Marius

    • Hi Marius,

      This error usually happens after a crash has stopped miRCat from being able to close it’s threads (I am working on fixing this at the moment)

      If you look at the process explorer (top on Linux) you will probably see loads of java instances hanging around doing nothing.

      Close them (killall java), hopefully this will then let your run continue πŸ™‚

      Cheers,
      Matt

      • Marius Snyman

        Thanx Matt. I’ll check it out, but now there’s another issue. My miRBase data is gone? Where do I get a file for the latest version of mirbase? and to which directory do I copy it before restarting the workbench?

        • Are you able to run the software from the GUI? If so you can just open the help menu from the main interface and click “update miRBAse” miRBase has just updated to Version 20 but I checked it from here and the update appeared to work ok.

          In other news, I have hopefully actually sorted this zombie process bug for the final release of V3.0. Perhaps I will include the ability to update miRBase from the command line too…

          • Marius Snyman

            No, I can’t run it off my computer due to memory limitations. So I’m running it via our server using X forwarding.

          • if you are fowarding the GUI to your console via X you should still be able to perform the update using the help menu assuming your server is internet facing.

            If it is not however, you could run the GUI on your desktop, click update miRBAse, then copy the all the files into the server installation. data/mirbase/20

          • Marius Snyman

            Okay, thanks Matt! Should’ve thought about that earlier πŸ™‚
            Does the miRBase miRNAs get flagged when miRCat predicts novel miRNAs?

          • It does but not as well as miRProf, unless the sequence is an exact match to one of the miRNAs in miRBase it will not report the code. I just added that part quite quickly without really thinking about it, so if you have sequenced an isomir or there is a mismatch you may not find the code (it will just report N/A). For now I advise that people output the miRNAs from miRCat to FASTA and then run it through miRProf if they want to identify the known sequences.

            I think the best thing for me will be to automate this procedure and scan the results after miRCat has completed to fill in this column because running miRProf on each sequence as it is predicted will add too much runtime (I would think!)

          • Marius Snyman

            Dear Matt,

            I would just like to follow up on the miRProf step that can be used to filter out the miRBase miRNAs. I have too outputs after the miRCat run completed: A hairpin fasta file and a mature miRNA fasta file. Which do I use for input in miRProf? I tried using the mature miR fasta file and the genome fasta file but I get this message: For input string: “10”.

            Can you please assist in this matter?

            Marius

          • The sRNA Workbench

            Hi Marius,

            I have replied to your email also, but for anyone else seeing this problem. You would typically run the miRNA fasta file from miRCat through miRProf and take the disjoint set of data from the two files.

            However, miRProf requires integer values for the abundance and the latest change outputs fractional values so it can handle normalised abundances! I wil fix this problem for a future release. Thanks for pointing it out!

            Cheers,
            Matt

          • Marius Snyman

            Hi Matt,
            I did as you said, and used the “killall java” command and restarted. After a while of processing, I get the following message repeating itself:
            ConnectException: Connection refused
            at java.net.PlainSocketImpl.socketConnect(Native Method)
            at java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:339)
            at java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:200)
            at java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:182)
            at java.net.SocksSocketImpl.connect(SocksSocketImpl.java:391)
            at java.net.Socket.connect(Socket.java:579)
            at java.net.Socket.connect(Socket.java:528)
            at java.net.Socket.(Socket.java:425)
            at java.net.Socket.(Socket.java:208)
            at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.sendMessage(BinaryExecutor.java:217)
            at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.execRNAFold(BinaryExecutor.java:130)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.getStructure(Window.java:1368)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processSingleWindow(Window.java:746)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processWindows(Window.java:323)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.run(Window.java:121)
            at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1110)
            at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:603)
            at java.lang.Thread.run(Thread.java:722)

            I don’t know what it means but it is making the run fail?

            Cheers,
            Marius

          • had the program predicted any miRNAs before this happened?

      • Marius Snyman

        Yes, it did. But I only saw them in the table of the GUI, not in the results folder. The results folder only had a few hairpin files.

        • yes they remain in the GUI until you export the results into any of the available formats either through the toolbar or the export menu.

          It appears as if something forced the connections to the external threaded processes to close which is odd (unfortunately LINUX java forced the software to be designed with a client server model to run external programs which causes a lot of annoying problems at times).

          It can happen sometimes when all results are predicted but by the look of that error some sequences were still in the thread queue waiting to be processed…

          Could you zip up the log files (user/logs) and send them to me? matthew.stocks@uea.ac.uk they might shed some light on why this happened.

          If you are needing results while I investigate you could consider running with less threads (controlled from the parameter window) maybe lower the number which will of course increase the run time but perhaps allow your job to finish

  • Tibor Nagy

    Hi Matt,
    I have used mircat (Workbench 2.5.0) under Kubuntu 12.10 (64bit) without any serious problem, but after the distribution upgrade (Kubuntu 13.04) I do not get any output. I have tried to run it with java6 update 45, java 7 update 25, but it does not help. Have you any idea what should be the problem?
    (I also tried to run in command line and the 3.0.1 alpha)

    • Hi Tibor,

      It is difficult to say. If it worked prior to the distribution upgrade something must have changed in your environment.

      Did you ensure the 32bit libraries were included during the update procedure? It may be worth checking they are there and if not installing the package. You could send me the logs from the failed run and I can try and figure out what happened… (matthew.stocks@uea.ac.uk)

      Cheers,
      Matt

      • Tibor Nagy

        Thanks, that was the problem! After I installed ia32-libs, mircat working again.

        • great πŸ™‚ let me know if you have any further issues.

          Cheers,
          Matt

  • Alice Lunardon

    Hi Matt,
    I have a quick question: does miRCat map the reads to the input genome searching only for perfect matches or allowing mismatches?

    Thank you very much!

    Best wishes

    Alice

    • Hi Alice,

      miRCat only allows for putative miRNA (or other small RNA) that have an exact match to the genome to be added to the locus. You could probably force something different to happen if you need to, just align the sequences using the sequence alignment tool and choose your mismatch options, then use the file it creates as input to miRCat rather than loading the sRNAs directly…

      This is completely untested on my end though! You may end up with a huge amount of results this way!

      I hope this helps πŸ™‚

      Best wishes,
      Matt

      • Alice Lunardon

        Hi Matt,
        I am interested to the reads that map to the genome with an exact match, I only wanted to be sure of that!

        Thank you very much!

        Alice

  • Alice Lunardon

    Hi Matt,
    I also tried to use miRCat, the process seems to run but when it is complete I don’t get the results, I see “Status: completed successfully” but the screen is empty, do you have suggestions for that problem?

    Thank you!

    Alice

    • Alice Lunardon

      If you want I can write you a private e-mail in which I give you the username and the password of my account in the server, maybe if you make a try with my data it would be easier to understand what is the problem (I tried in another server the same tool and it gave this error message: “input string: 2,78” or “input string: 3”)

      Thank you very much for your help!!

      Alice

      • Comment resolved now privately, topic is closed

  • Ken

    Hi,
    I’m using v2.4 workbench – I have exported the miRCat output to a .csv file. I have two questions:

    1. The input sRNAs were already made non-redundant. I am seeing a discrepancy between the ‘Genomic Hits’ field, and the actual number of miRNAs listed/detected in the .csv file. For example, a particular sequence is reported to have 13 ‘Genomic Hits’, but I can only find 5 genomic loci in the same file. I’m seeing this for many sequences. What is the cause for this?

    2. How does miRCat deal with sequences that are a ‘subset’ of a longer sequence? e.g. a 21 nt miRNA that has the same sequence as a 22nt miRNA? Are these classified as separate?

    Many thanks,
    Ken

    • Ken

      I just read a comment below about the number in the brackets in the fasta file output being genomic coordinates, which is what I am seeing in my fasta output too. Perhaps my question 1 will be solved in the latest version. I’ll try the latest version to confirm this.

    • Hi,

      1: Just need a little clarification on which bits of info you are looking at, Genomic Hits are the number of times the individual sequence aligned to the genome (i.e. if you used the sequence alignment tool on its own, you would find that sequence n number of times in different locations) is the value you are referring to in the CSV the number of times that particular read was sequenced? Or the number of times it was reported as being a miRNA in the results?

      2: Do you mean specific isomirs that have been sequenced here? we currently treat each sequence as having the potential to be a miRNA and do not look to see if they are isomirs of another miRNA (but it is an interesting thought! perhaps I can look to include something like this! It is considered in miRProf already)

      cheers,
      Matt

      • Ken

        Hi Matt,

        1. The value I am referring to is found in the ‘Genomic hits’ column in the exported CSV file, which is column 14 (by the way, the columns in the actual CSV file do not correspond to the explanations given on this page above). I am assuming this is the number of times that the particular predicted miRNA aligned to the genome. It is not the read abundance. Actually, I may have just answered my question … I assumed that the number of genomic hits would equate to the number of genomic loci reported for the particular miRNA, but this is not the case I think? So if the particular miRNA had 13 genomic hits, perhaps only 6 of these hits had evidence to actually support the sequence to be a true miRNA, which is what is reported in the CSV file? Put another way I found 6 instances of a miRNA sequence in the CSV file, yet the number of genomic hits was reported to be 13.

        2. Yes I am referring to isomirs. It would be good to know the %’s of these within the dataset – I have around 3900 potential miRNAs from miRCat, but it would be good to know how many actual families there are. I guess I could use the fasta output from miRCat, make them redundant again based on the read counts, and use this as input to miRProf to just get the classifications. However, I would miss novel families. Do you have a tool to just detect isomirs?

        cheers,
        Ken

        • Hi,

          1) Genomic hits will be the exact number of times that sequence aligned to the genome, however, as you have suggested, not all of those hits might be considered a miRNA if (for example) the flanking region around it did not fold into a hairpin (there could be other reasons it was not classified in that location as a miRNA) the program does not take into account if a particular sequence has already been classified.
          2) miRProf should be able to read your non-redundant output from miRCat provided you are using the workbench version not the perl/online version. This should give you the information on which sequences belong to which family etc. There is not a tool that will tell you specifically which sequence are isomirs of each other but miRProf will group all sequences that align to a certain miRNA found in miRBase (you can see them all by dropping the arrows down in the interface) however, you will find the output CSV from miRProf is not quite functioning correctly at the moment (I am fixing it for the next release) but you can see them all in the GUI output
          Cheers,
          Matt

  • DIvya Patel

    hii Matt,
    i am using mircat tool in sRNAWorkbenchv2.3.1and i had done adaptor removal,filter and sequence alignment.i have used input as .patman file in mircat and select default parameter of plant. now,i am getting error in mircat like “mircat connection lost” then if i am trying next time then error like “this port is already in used”.
    What am i supposed to do?
    thank you.

    • Hi,

      More than likely the program did not close correctly at some point and some zombies are hanging around on the ports the software wants to use. Could you kill any java processes related to your login? Depending on OS this can be done with a single command. Let me know if you need help with this!

      After killing any java processes attempt to run the software again and let me know if it works for you πŸ™‚

      Cheers,
      Matt

  • yan

    Hi,Matt,
    I am not quit sure about the mean of the mirCat output,please give a hand.I had our smRNA data processed by mirCat and got the output,while when I export the miRNA to files,I got file like this:
    >TCGGGCCAGAGATTCGGACCTT(74)
    TCGGGCCAGAGATTCGGACCTT
    >TTGACAGAAGATAGAGAGCAC(134)
    TTGACAGAAGATAGAGAGCAC
    >GATGAACATTAGCGCTAGAGCTGA(649)
    GATGAACATTAGCGCTAGAGCTGA

    what is the mean of the number in the title,and how do you get it,can I directly compare it among different smRNA libs?

    • Hi Yan,

      The value in the brackets is the non-redundant count of that sequence. All FASTA files are converted to (if not already) a non-redundant format prior to processing, so the sequence

      TCGGGCCAGAGATTCGGACCTT

      appeared 74 times in your original input set and as such was selected as the most abundant small RNA within that locus (therefore used for further testing for miRNA viability, all of which it passed).

      To directly compare sequence abundance among different libraries you will first need to normalise the abundance data.

      I hope this helps!
      Matt

      • Nathaniel Street

        I just ran some mirCat analyses and in the mature miRNA fasta files the number in brackets are actually the start coordinate in the genome and not the abundance (I checked this by comparing to the GFF and the results in the csv file). Is this a known bug?

        • Is certainly is! But one I spotted only a couple of days ago.. I usually just go by what is in the table until I output some FASTA for one of the wet lab guys downstairs and thought…. hmmm that abundance is larger than the entire sample!

          I have fixed it and included it on my forthcoming release which is close to being ready πŸ™‚

          Thanks for letting me know though!

          Best wishes,
          Matt

      • yan

        Hi Matt,
        I noticed a problem,I use the same data and same parameters to run mirCat ,while sometimes I could not get the same rusults ,for example,once I got 593 predicted miRNAs,and once I got 580 miRNAs.
        I think this maybe caused by fail output of some thread,if so ,how should I solve this problem? Here are some information warning during the run:
        Dec 10, 2012 8:10:05 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
        SEVERE: WORKBENCH: java.lang.String.substring(Unknown Source)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.getStructure(Window.java:1403)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processSingleWindow(Window.java:741)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processWindows(Window.java:318)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.run(Window.java:121)
        java.util.concurrent.ThreadPoolExecutor.runWorker(Unknown Source)
        java.util.concurrent.ThreadPoolExecutor$Worker.run(Unknown Source)
        java.lang.Thread.run(Unknown Source)

        Dec 10, 2012 8:10:29 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
        SEVERE: WORKBENCH:
        java.lang.StringIndexOutOfBoundsException: String index out of range: -1
        at java.lang.String.substring(Unknown Source)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.getStructure(Window.java:1403)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processSingleWindow(Window.java:741)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processWindows(Window.java:318)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.run(Window.java:121)
        at java.util.concurrent.ThreadPoolExecutor.runWorker(Unknown Source)
        at java.util.concurrent.ThreadPoolExecutor$Worker.run(Unknown Source)
        at java.lang.Thread.run(Unknown Source)

        Dec 10, 2012 8:10:29 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
        SEVERE: WORKBENCH: java.lang.String.substring(Unknown Source)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.getStructure(Window.java:1403)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processSingleWindow(Window.java:741)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processWindows(Window.java:318)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.run(Window.java:121)
        java.util.concurrent.ThreadPoolExecutor.runWorker(Unknown Source)
        java.util.concurrent.ThreadPoolExecutor$Worker.run(Unknown Source)
        java.lang.Thread.run(Unknown Source)

        Dec 10, 2012 8:11:41 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
        SEVERE: WORKBENCH:
        java.lang.StringIndexOutOfBoundsException: String index out of range: -1
        at java.lang.String.substring(Unknown Source)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.getStructure(Window.java:1403)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processSingleWindow(Window.java:741)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processWindows(Window.java:318)
        at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.run(Window.java:121)
        at java.util.concurrent.ThreadPoolExecutor.runWorker(Unknown Source)
        at java.util.concurrent.ThreadPoolExecutor$Worker.run(Unknown Source)
        at java.lang.Thread.run(Unknown Source)

        Dec 10, 2012 8:11:41 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
        SEVERE: WORKBENCH: java.lang.String.substring(Unknown Source)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.getStructure(Window.java:1403)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processSingleWindow(Window.java:741)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processWindows(Window.java:318)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.run(Window.java:121)
        java.util.concurrent.ThreadPoolExecutor.runWorker(Unknown Source)
        java.util.concurrent.ThreadPoolExecutor$Worker.run(Unknown Source)
        java.lang.Thread.run(Unknown Source)

        • Hi Yan,

          Yes as you correctly say, this is most likely due to a fail on one of the process threads. It is difficult to say exactly why this happened, it could be a program error/bug or a problem with the input data. You could try downloading the latest version of the program and reducing the thread count down to just 1 and see if the error persists (this will of course increase the run time) or send me a small sample of the data and I can look at it and see if I can re-create the problem

          Let me know!
          Thanks,
          Matt

  • Angus

    Hi Matt,

    We’ve made a transcriptome dataset, and now I’m trying to annotate it for miRNAs. We’re using 454 reads from a non-normalised library which have already had their adaptors removed. My main problem is that when I try to run filter or mirCAT it either returns no valid sequences; or that my data file may be non-redundant. Is this an incompatibility with the program and 454 for example?

    P.S. I’m using the web-based server.

    Kind Regards,
    Angus

    • Hi Angus,

      I believe the web version does require the files in non-redundant format (the downloadable version can handle both). However, 454 reads should be ok. Could you send me the first few lines of your input files and I will see if I can work out what the problem might be?

      matthew.stocks@uea.ac.uk

      Thanks,
      Matt

      • Angus

        Hi,
        Thanks Matt, I’ve sent you the first lines,
        A

        • Hi Angus,

          Ahh now I see what you mean, sorry about that!

          Ok, miRCat requires small RNA reads to predict miRNA sequences and will not annotate transcript data. Did you sequence small RNA sequences in parallel with this experiment? If not, the best you can do is use BLAST to annotate the known miRNAs within the transcriptome.

          Hope this helps,
          Matt

          • Angus

            Hi,

            There are sRNA reads within the data set. When filtered with the Filter tool they do get flagged up (about 2000 in the 23nt range), but these cannot be mapped against any genomes or even the entire miRNA data set. The program suggests either adaptors have not been removed or that I am mapping to the wrong genome, but that can’t be a problem because it’s being mapped against everything.

            Cheers,
            A

          • Hi Angus,

            Apologies for the delay in replying to this I have been away on annual leave last week.

            I would say that although it is possible you have some small RNA reads in your data, you would be very lucky to find a real micro RNA with only 2000 sequences to search through. (also, I believe the web based version of miRCat will discard all reads with an abundance of 1 but this can be configured by the user in the downloadable workbench if you wish to bypass this behaviour)

            My suggestion would be to run the small RNA reads you have through miRProf and this will at least tell you if you have any known micro RNA within your data. If you have none, then it is unlikely you have any new ones also.

            In regards to the mapping issue, are you sure you have the correct adapter sequence? Did you receive any information on which adapter was used during sequencing?

            Thanks,
            Matt

  • Kavitha

    Hai,
    I was using miRCat for analyzing my small rna sequenced data. Where could I get a complete Arabidopsis genome sequence.Also, while removing adaptar sequences using helper tool, I am getting out of memory error. My system is having 8GB RAM. I would like to have your suggestion to overcome this problem.

    • Hi Kavitha,

      the best location for the A.TH genome is the TAIR website:

      ftp://ftp.arabidopsis.org/home/tair/Genes/TAIR10_genome_release/TAIR10_chromosome_files/

      the full genome is the file called TAIR10_chr_all.fas (or you can download each chromosome separately from here also)

      @Overcoming the memory issue:

      It depends, how large is your initial input file? Is it a single A.th sample? How are you running the workbench? Did you start it using the sRNAWorkbenchStartup.jar? Which OS are you using? 8GB of RAM is usually enough for even the largest files, did you have a lot of other memory intensive programs running at the same time?

      • Kavitha

        Dear Sir,
        Thank you for the reply.My initial output file is 7.7Gb.Yes I am using a single sample. I am starting it using sRNAWorkbenchStartup.jar. I am using windows 7. While using the small rna workbench,I am not running any other programs.

        • Ok that could be too much data for that amount of memory. Could you send me the first 100 or so lines of the small RNA file that you input into the Adapter Removal tool? So I can check the data looks ok.

          send to: matthew.stocks@uea.ac.uk

          You may need to strip the adapters using the web based service if you do not have access to a server or PC with slightly higher memory capacity to run the workbench from

  • G. Velmurugan

    Hello,

    I am using this workbench for analyzing my small RNA sequencing data. I have a question. From where, I can download the genome file. I am using rats for my experiment. I tried to download from ensemble, but it has many files corresponding for each chromosome. But it seems in miRcat, we need a single genome file. How to achieve this?

    Thank you

    Sincerely,
    Velmurugan
    Madurai Kamaraj University, India

    • Hi Velmurugan,

      miRCat will work with single chromosome files or the entire genome, sometimes it is better to work with single chromosomes for certain data because the entire genome file is too large to fit within memory. For example, people working with human data often just map their small RNA reads to a single chromosome and then use that file for there analysis (or you can map your reads to the entire genome using our sequence alignment tool and then use single chromosome files within miRCat.

      If you want to use an entire rat genome file you can find one here:

      ftp://hgdownload.cse.ucsc.edu/goldenPath/rn5/bigZips/

      there is a web page describing each of the files within the directory linked above

      http://hgdownload.cse.ucsc.edu/goldenPath/rn5/bigZips/

      and the file with all the chromosomes is called rn5.2bit or this is also a fasta gzipped download called (rn5.fa.gz) which will contain the same information.

      Please feel free to let me know if you need any further help!

      Best Wishes,
      Matt

  • GUNEET

    Hi
    I have pre miRNA sequences of plants,can i have primary miRNA sequences from it by computational method.Also suggest suitable publication / literature.

    • admin

      Hi,

      Please refer to my reply below to Chintan Vora regarding pri-miRNAs and detection within miRCat.

      In addition, a possible common motif in pri-miRNA was detected and mentioned in Bartels talk on “Systems Approaches to miRNAs” at Keystone Symposia on Molecular and Cellular Biology: Gene Silencing by small RNAs this year:

      http://www.keystonesymposia.org/meetings/viewMeetings.cfm?MeetingID=1177

      Hope that helps.

      Kind regards,
      Matt

  • Chintan Vora

    Can we change the adapter sequence in miRCat other than the default 3 sequences provided?

    • admin

      Yes you can change the adapter sequence after enabling the Adapter Removal panel using the check box. Simply type the desired 3′ or 5′ adapter sequence into the box(es) provided in the interface (just above the drop-down menu where you can select the provided sequences.) The drop-down menu is just there for convenience. Alternatively you can access all of these options from the stand alone Adapter Removal tool.

  • Chintan Vora

    Can we identify polycistronic miRNA using sRNA workbench?

    • admin

      Yes miRCat can identify pre-miRNAs from the same primary transcript but does not attempt to classify pri-miRNAs (and will therefore treat each pre-miRNA as a separate entity). If you need any further information please dont hesitate to ask!

      • Chintan Vora

        Thank you for the reply but i am interested in identifying polycistronic miRNA(pri-miRNA). Can you suggest any tool or publications which can list the features of pri-miRNA.

        • admin

          Usually pri-miRNAs are identified based on clustering pre-miRNAs based on distance between loci. E.g. miRBase uses an arbitrary threshold of 10Kb, any miRNAs within that distance are grouped into the same putative pri-miRNA. As far as I know there are no published computational methods that will accurately identify pri-miRNAs and no way of telling from small RNA sequencing what the start/end of these primary transcripts is.

          miRCat may miss miRNAs that are in close proximity to one another as it will group all neighbouring sequences together into loci before folding them and analysing the secondary structure (therefore two different miRNAs may be joined into one locus and will fail the structure prediction step). For this reason you may need to lower the “locus separation distance” in order to differentiate between miRNAs within close proximity to one another.

  • Chintan Vora

    How do i update mirbase in mircat?

    • admin

      Hi,

      RE your problem with miRBase (copied from another response)

      you may be experiencing an issue related to Java 1.7 when attempting to download/update miRBase files (related to support for IPv4, Java are aware of the problem but I am not sure when their updated code will be available). We are attempting to add a work-around at the moment.

      The software should work fine on Java 1.6 (any update). If you want instruction on how to use an earlier version of Java please let me know.

      Please let me know if I can be of any more help,
      Thanks,
      Matt

A suite of tools for analysing micro RNA and other small RNA data from High-Throughput Sequencing devices