The UEA small RNA Workbench Version 3.2

The small RNA Workbench Version 3.2: Released: 20/05/2014

A new version of an existing tool has been added to this version as a beta. Details are below. Also includes bug squashing and general software updates. All details can be found below:

Download

General

  1. A more informative message is now given to the user and written to the log if the input file has bad formatting or invalid lines that will cause the software to crash
  2. A fix for GA tracking data initialization occasional crashes from the command line

Adapter Removal LM (Low Memory)

The first in a set of major changes to the underlying data structure of the sRNA Workbench. Memory was becoming a major issue so our focus switched toward strategies for counteracting the large volumes of data our users wanted to process using the workbench. The new Adapter Removal tool (currently shown as Adapter Removal LM beta) can be used in exactly the same way as the old tool with one change,  the users will notice a redundant version of the direct FASTQ to FASTA conversion in their output directory. Further details can be found in the new series of diary posts I will be making for the new tools. The adapter removal low memory diary can be found here.

Adapter Removal (All Versions)

  1. The GUI no longer outputs HD stats if the HD adaptor trimming option was not selected

VisSR

  1. Users now have the option to change the background colours and colours of the glyphs used to represent; GFF annotations, Aligned small RNA files (including the aggregated mode) and the backgrounds of all tiers to suit their usage. Users should use the help->settings menu on the VisSR panel to change the colours they are interested in.

RNA annotation

  1. A new version of Ghost Script has been included that no longer requires an X11 build to be present on OSX computers (as support for X11 was removed in Mountain Lion)

CoLIde

  1. A bug that left a hardcoded value in place for the offset absolute differential expression value has been fixed
  2. Rounded P values that read 0 have now been replaced with a more informative message. Remaining P values have been rounded to two significant figures

miRProf

  1. The CLI output now matches the updated output style created for the GUI mode
  2. Fixed an issue in GUI mode where genome matches were not being summed up correctly
  3. Fixed an issue where normalised counts were being summed over rows incorrectly
  • HT Chung

    Hi Matt,

    As your instruction, I ran “Sequence Alignment” from “The UEA sRNA Workbench”.
    1. Short Reads File Path: hairpin_plant.fa, hairpin_plant_dnaform.fa, mature_plant.fa, mature_plant_dnaform.fa
    2. Long Reads File Path: A fasta file of my plant scaffolds data (2.5G)
    3. I did not check “Enable Pre-Processing”.

    After this, four .patman files were generated but only two .patman files (mature_plant_Align.patman [1kb] and mature_plant_dnaform_Align.patman [261kb]) contained some info (in particular, mature_plant_dnaform_Align.patman). Is this normal?

    Re output file, I could understand most of aligned output info but what does the number mean in the bracket right after nucleotide sequence “TCGGACCAGGCTTCATTCCCC(154)”?

    Many thanks in advance!
    Cheers,

    Taek

    • The sRNA Workbench

      Hi Taek,

      Not sure exactly why so many files were generated there, it seems a little odd. I will look into it.

      The count 154 is how many copies of that sequence existed in the your original input file. It is because the tool is mainly for HTS data, so for example, if you sequenced the same miRNA 1000 times instead of processing it 1000 times the software processes it once and then reports the abundance of that sequences (redundant versus non redundant data)

      Hope this helps,
      Cheers,
      Matt

  • HT Chung

    Hi Matt,

    Thank you for the quick reply.
    I am not quite sure but there might be some Illumina and PE-mate reads available.
    Apart from this, I am simply trying to screen sRNAs (mainly microRNA) against the current scaffolds data. And then, I want to generate .gff3 file between microRNA and scaffolds. I have already tested the hairpin.fasta & mature.fasta files from miRBase to blast against the scaffolds but I want to make sure. What is your recommendation?

    Cheers,

    Taek

    • The sRNA Workbench

      Hi Taek,

      I would actually just use a standard sequence aligner and align the mature miRNA sequences from miRBase against the scaffolds (the sequence aligner in the workbench will do the job or any aligner as long as it reports all possible alignments) with no gaps or mismatches to find the miRNAs.

      However, if I understand correctly you want to build a GFF file for a presumable non annotated (new) organism? If so you will probably need to write some kind of parser that will process the aligned sequences and writes them back out in GFF format (the sequence aligner will give all of the positions that a single sequence aligned to.)

      miRCat is really more for predicting new miRNAs from sequence data rather than searching for all miRNAs in an organism.

      Hope this helps,
      Cheers,
      Matt

  • HT Chung

    Dear The UEA small RNA Workbench,

    I have a few questions about running “srna-workbenchV3.2” under Window system.
    After a successful installation, I have activated the software by double clicking “UEA_sRNAWorkbench.exe”.

    Here are the steps I actually followed.

    1. Tools > Analysis Tools > miRCat (Successfully downloaded miRBase)
    2. In miRCat window, > miRCat File > New Project > Options, Specifiy sRNA File (I have tried both “hairpin_plant.fa” and mature_plant.fa) > Specify Genome File (I have imported a plant scaffold file_2.5G).

    Since the scaffold file does not contain any “Adaptors”, I did not perform any “Remove Adaptors” and “Filter Input”. After this, I just cliked “OK”. Another window showed up right at the right side. From the “MiRCat Information” window, I checked “Set Default Plant Parameters” and “miRCat Log”. Finally, I clicked “Start”.

    After this, it seems like it was running but at the end there was no file (a few minutes later). So I ran again by clicking “Run” to see if there is any difference. However, there is no luck at all.

    Do you think I missed a key step (or imported a wrong input .fasta file) or something?
    Looking forward to your reply.

    Best regards,

    Taek

    • The sRNA Workbench

      Hi Taek,

      miRCat essentially works with some HTS data you have in FASTA format (that is what you would remove the adaptors from if it was in raw FASTQ format) and a genome, the mature.fa file that is retrieved from miRBase is then used to match those sequences that are already “known”. I think maybe the file you are using as input (not the genome) needs to be something else.

      Do you have any raw sequencing data you are interested in? Or are you simply trying to identify all the miRNAs within your scaffolds?

      Cheers,
      Matt

      • Kun Yang

        Dear Matt,

        Things described above happened to me too when I used
        my small RNA data. So I used your data in tutorial instead. Same things
        happened. Right after I clicked “run” miRCat begin processing data (Fig. 1), but soon after it finished nothing responded (Fig.2). I checked my output folder, nothing deposited in it, not even the log files. How this happened? My OS is ubuntu 15.04 and my java is JDK version 1.8.0_51 download from oracle.

        best regards
        kun yang

        • The sRNA Workbench

          Hi Kun,

          Can you try shutting any running instances of java down, deleting all of the files found in user/logs and run again?

          Cheers,
          Matt

  • Federico Rossi

    Hi,
    I performed a miRNA analysis using miRProf and as results I obtained miRNA with a length included between 18 and 22 nucleotide. I obtained the same results with different combination of parameters such as min and max length, number of mismatches allowed.
    I repeated the analysis aligning my sRNA to miRBase 21 (the same database used by miRProf) using the following command: bwa aln -t 4 -n 2 -o 0 ../../srna-workbench/3.2/data/mirbase/21/mature_plant.fa $file >$file.sai and I obtained miRNA with length distribution included between 16 to 35.

    Thanks,

    Federico

  • Irene

    Hi Matt,

    Thank you for the quick reply! I now tried your suggestion, but still nothing happens…

    if I type “java -jar Workbench.jar” it says “java is not recognized as an internal or external command, etc.
    So, I tried several combinations, but nothing…

    Cheers,
    Irene

  • Irene

    Hi,
    Just tried to install the program (did not have it yet and would like to analyze my data). However, after following the instructions and opened the sRNAWorkbenchstartup.rar, it initialy opens but during initialization of the “PareSnip” it disappears and nothing happens. So till now not been able to work with it. How can I fix this problem?
    – I restarted (Windows 7) computer several times
    – Installed newer version of Java
    Thanx, Irene

    • The sRNA Workbench

      Hi Irene,

      Could you launch the program from the command line? If you navigate to the srna-workbench and type java -jar Workbench.jar does it launch?

      Cheers,
      Matt

      • Irene

        Hi Matt,
        I reinstalled Java, and copied the entire folder to the desktop, and surprisingly it started working!
        the script is now running,
        thank you,
        Irene

        • The sRNA Workbench

          Hi Irene,

          Sorry for the delay in response and approval for posts I was on leave last week.

          Thats good news! Probably it was either related to environment variables getting set by the java installer or some kind of issue with running the workbench from a particular location that was fixed when moving it to the desktop. I will look into it…

          Cheers,
          Matt