This tool produces the secondary structure of a long (up to 1kb) RNA sequence and annotates it by highlighting up to 14 comma separated short sequences as required.
The tool produces a navigable image showing the position of miRNA candidate sequences on a precursor hairpin (see Figure below).

The tool can produce as many images as required when given a long (hairpin) sequence and optional short sequence(s) in that will be highlighted on the hairpin. These should be subsequences of the hairpin sequence. Each loaded hairpin can then be cycled through using the arrow buttons shown below.

A user has the option to save the current image or save all of the images loaded into the tool.
A user can also view the information regarding the state of the tool in the top right corner.

Here you can determine how many images are currently loaded and by hovering over the box a tool tip appears describing the hairpin sequence and the short read positions.
Colour of each sequence is controlled using the toggle buttons shown below:

To change the colour of a specific image in the list, select the sequence number and pick the colour from the chooser on the right.
The program will create secondary structure plots from any fasta formatted files that contain foldable RNA sequences, however, if the FASTA file is formatted in the same way as the miRCat output the miRNA and star sequence will be highlighted
The format in FASTA is as follows:
>maturemiRNA_SEQUENCE_miRNA*_SEQUENCE_CHROMOSOMEHEADER-PRECURSOR-START_COORD_END_COORD_MFE_VALUE_STRANDPLUSMINUS [Negative strand][Positive strand]
HAIRPIN
So all of the bold values will not change, and the non bold values must contain the required data. I have added an example below,
maturemiRNA: TTGAGCCGTGCCAATATCACG
miRNA*: AGATATTAGTGCGGTTCAATC
Chromosome header: “1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02”
PRECURSOR Start-End coord: 3961364, 3961453
Minimum Free Energy : -41.9
and it is on the negative strand
>maturemiRNA_TTGAGCCGTGCCAATATCACG_miRNA*_AGATATTAGTGCGGTTCAATC_1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02_PRECURSOR-START_3961364_END_3961453_MFE_-41.9_STRAND_- [Negative strand]
CGCGAGATATTAGTGCGGTTCAATCAAATAGTCGTCCTCTTAACTCATGGAGAACGGTGTTGTTCGATTGAGCCGTGCCAATATCACGCG