Quick-start

Running the sRNA Workbench in GUI mode

In order to run the sRNA Workbench in GUI mode, simply extract all the files from your downloaded zip archive to a new directory, then launch the sRNAWorkbenchStartup.jar. If running on Windows and you launch this jar but get no response there may be a slight problem with your java configuration. In this instance please launch the startup program from the command line using the command:

java -jar sRNAWorkbenchStartup.jar

This will scan your system for available memory and allocate a portion of it to the Workbench.

In the even that the startup program hangs or does not give enough memory for the job you can configure this by hand using the following command:

java -Xms$g -Xmx$g -jar Workbench.jar

Replace the $ symbol with the amount of RAM in GB you wish to assign to the workbench

For detailed instructions on each tool, please visit the Tools pages. Or for a quick overview on what the UEA sRNA Workbench can do and which tool you should select for the task then please visit this page. If you need help navigating to the directory and launching the program in this way please leave a comment and we will reply as soon as possible.

Alternatively, detailed help on each tool can be found from the “Help” menu when running the sRNA Workbench.

Running the sRNA Workbench from the command line

In order to execute the sRNA Workbench from the command line, navigate to the directory that you extracted the sRNA Workbench files to. Then type:

java -jar Workbench.jar -tool <toolname>

where <toolname> is the name of the tool you wish to use.

For each tool if no options are entered, the usage instructions will be printed to the command line. Note: parameters in square brackets are optional.

An example of a complete instruction is given below:

java -jar Workbench.jar -tool mircat -srna_file <srna-file> -genome <genome-file> [-params <params-file>]
  • Iddo Magen

    Hi, I entered the command: “java -jar Workbench.jar -tool mircat -srna_file tomato.fastq -genome TAIR10_chr_all.fas” using files in the tutorial folder, and there was an error message: “String index out of range: -24;”. What does it mean? Was there any mistake in writing the command correctly?

  • Menglin Zheng

    Hi Matt,

    I am new to use sRNA workbench. I would like to use linux version, but could not find the link. So could you send me the link? Thank you very much in advance!

    Best,
    Menglin

    • The sRNA Workbench

      Hi Menglin,

      The latest release notes can be found here with some links:

      http://srna-workbench.cmp.uea.ac.uk/the-uea-small-rna-workbench-version-3-2/

      All the actual downloads can be found here:

      https://sourceforge.net/projects/srnaworkbench/?source=navbar

      if the website does not detect that you are on a Linux OS and provide a direct link let me know.

      Here is a direct link to the Linux version just in case!

      http://sourceforge.net/projects/srnaworkbench/files/Version3.0/srna-workbenchV3.2_Linux.tar.gz/download

      Hope this helps!

      Cheers,
      Matt

      • Menglin Zheng

        Hi Matt,

        thank you very much for your reply. I have downloaded the workbench. But when I run java -jar Workbench.jar, it showed an error as follow:Exception in thread “AWT-EventQueue-0” java.lang.RuntimeException: java.lang.UnsatisfiedLinkError: Can’t load library: /home/zmlzs/srna-workbenchV3.2_Linux/lib/amd64/libglass.so

        at com.sun.javafx.tk.quantum.QuantumToolkit.startup(QuantumToolkit.java:284)

        at com.sun.javafx.application.PlatformImpl.startup(PlatformImpl.java:127)

        at javafx.embed.swing.JFXPanel.initFx(JFXPanel.java:182)

        at javafx.embed.swing.JFXPanel.(JFXPanel.java:199)

        ……
        What is the problem? Do I need to install the javafx or swing or sth else?

        Best,
        Menglin

        • The sRNA Workbench

          Hi Menglin,

          I saw this error from another Linux user, they had the OpenJDK installed. I am not sure exactly if this is the issue because I am still waiting for them to tell me if it fixed it! But the software really works best using the Oracle build of java.

          Could you go ahead and install the JDK version 8 from the Oracle website and try to run again? Do you need any instruction on how to do this? If so please let me know which OS you are using etc.

          Best wishes,
          Matt

          • Menglin Zheng

            Hi Matt,

            my OS is Ubuntu 14.04.2 LTS (GNU/Linux 3.13.0-32-generic x86_64). It would be great if you tell me how to do it, because I am newer. Thank you very much.

            Best,
            Menglin

          • Menglin Zheng

            Hi Matt,

            I would like to install JDK 8. But I don’t have root write permission. So I can’t remove the open JDK. How could I install and use JDK8 instead of Open JDK, rather than remove Open JDK? Thank you.

            Best,
            Menglin

          • The sRNA Workbench

            Hi Menglin,

            The Oracle java can be installed without root access and then you change a system variable that refers to the jdk location.

            Do you have easy access to a tech support team though? (i.e. whoever has got root access to the server) because the easiest thing would be to just get them to install it system wide to be honest.

            However, if not (or if the system admin doesn’t want to leave the OpenJDK) it is not too much work to get it just for you I should think (although I have not tried this on Ubuntu) just download the JDK from the oracle site:

            http://www.oracle.com/technetwork/java/javase/downloads/jdk8-downloads-2133151.html

            (64 bit linux)

            Then extract it somewhere in your $HOME and then set JAVA_HOME to the root of the extracted files and append $JAVA_HOME/bin to the PATH.

            Hopefully that will do it, type

            java -version

            into the terminal to find out if it worked 🙂

            Let me know if this helps/works/is not clear!

            Cheers,
            Matt

          • Menglin Zheng

            Hi Matt,
            I tried to set JAVA_HOME to ~/.bashrc and append $JAVA_HOME/bin to the PATH. But I checked it still shows Open JDK version. Maybe I just asked the server maintainer to install it on the system. Thank you very much for your help. If it works, I will tell you.

            Regards,
            Menglin

          • The sRNA Workbench

            Hi Menglin,

            JAVA_HOME needs to be set to the directory you unpacked the JDK install to. If this doesnt help let me know if the support team can get it installed and if it solves the issue!

            Cheers,
            Matt

          • Menglin Zheng

            Hi Matt,
            I did as follow:
            1. download JDK 8 named jdk-8u51-linux-x64.tar.gz from Oracle website;
            2. tar zxvf jdk-8u51-linux-x64.tar.gz , result in jdk1.8.0_51;
            3. vim ~/.bashrc
            4. JAVA_HOME=/home/zmlzs/jdk1.8.0_51
            export PATH=$PATH:$JAVA_HOME/bin (adding these in .bashrc)
            5. I logout and login again, type java -version

            But it shows the version of OpenJDK, rather than my java. So I am not sure
            what is the problem. Is there something wrong in my steps above.

            Best,
            Menglin

          • Menglin Zheng

            Hi Matt,

            now the java works. But there is a new problem. My GLX version is 1.2. But sRNA Workbench needs 1.3 or higher. 🙁

            Best,
            Menglin

          • The sRNA Workbench

            Hi Menglin,

            That shouldn’t matter to be honest. Does the software still not boot after this?

            Cheers,
            Matt

          • Menglin Zheng

            Hi Matt,

            finally the software works. But now there is a new problem. When I would like to use mirprof, it shows that I should download new version of mirBase. But it failed. In terminal, it shows that can’t get a working version of miRBase: Connection timed out. I think there is no problem for my internet. Is there somebody else having the same problem?

            Best,
            Menglin

          • The sRNA Workbench

            Hi Menglin,

            Are you sure you have access to the internet with that computer? What error does it give you when attempting to update miRBase?

            Cheers,
            Matt

          • Menglin Zheng

            Hi Matt,

            I used Cisco vpn client connect to the university’s VPN, and then login our server. When I update miRBase, it shows connection timed out.In the log file, it shows that: INFO: WORKBENCH: Error making tracking requestConnection timed out.

            Best,
            Menglin

          • The sRNA Workbench

            Hi Menglin,

            It is possible that your server has no outward facing port to access the internet.

            You may have to manually install miRBase instead. I will be making a web page to instruct people on how to do this because it is fairly common that servers do not have direct access to the internet in this way.

            Right now, I would run the software locally on your laptop or desktop, load miRProf and update miRBase from there (assuming you cannot process the data locally? miRProf is not that hungry for system resources so you may find you dont actually need to use a server to run that program). If you cannot run the program locally, after updating miRBase, go to the folder data/mirbase and copy the structure of the folder and all of its contents into the mirbase folder on the server install. This will allow miRProf to run.

            Let me know if this helps,
            Best wishes,
            Matt

          • Menglin Zheng

            Hi Matt,

            I did as you said, now it works. Thank you very much for your help and patience.

            Best Regards,
            Menglin

          • The sRNA Workbench

            Great!

            Let me know if you have any further questions

            Best wishes,
            Matt

          • David Clark

            I am also using VPN tool in US as this is best for accessing. I have found this tool best in many ways as i can access blocked content in any region including universities that the reason i suggest everyone to use it and go to VPNRANKS and choose the best VPN for you.

      • Menglin Zheng

        And my java version is :

        java version “1.7.0_79”

        OpenJDK Runtime Environment (IcedTea 2.5.5) (7u79-2.5.5-0ubuntu0.14.04.2)

        OpenJDK 64-Bit Server VM (build 24.79-b02, mixed mode)

  • Amrita Yadav

    Hi Matt,

    i have downloaded the small UEA small RNA workbench and
    installed on my system . But its not working properly , i am using using ubuntu 15.04 and java version “1.8.0_45”. i run the command –
    java -jar Workbench.jar -tool mircat -srna_file 1_AT_R1.fastq -genome all_reference.fasta.
    After that program is closing automatically by the following error –
    UEA sRNA Workbench startup…
    Jun 01, 2015 2:28:51 PM uk.ac.uea.cmp.srnaworkbench.utils.LOGGERS.WorkbenchLogger log
    WARNING: WORKBENCH: Had to convert all_reference.fasta to unix style for PatMan.
    initial setup ok, miRCat is now processing…

    Please help me to solve the issue.
    Thank You

    • The sRNA Workbench

      Hi Amrita,

      Could you let me know if anything was written into the log files?

      user/logs

      Cheers,
      Matt

      • Amrita Yadav

        Hi Matt
        Thanks for your response. But i have solved the problem. Now i am able to use it properly.

        Thank You !

        • The sRNA Workbench

          Hi Amrita,

          Ok great news! if possible, could you let me know what solved it? Just in case anyone else faces the same issue!

          Cheers,
          Matt

          • Amrita Yadav

            I just change the fastq format into fasta format and get job done.

            Thanks

          • The sRNA Workbench

            ahh I see, the software should probably have picked that up but perhaps it is a bug somewhere. I will look into it…

            Cheers for getting back to me.
            Matt

      • Amrita Yadav

        Hi Matt
        Thanks for your response. But i have solved the problem. Now i am able to use it properly.

        Thank You !

  • The sRNA Workbench

    Hi Katja,

    The sequence alignment tool is currently not available from the command line. It was something I have not had time to fully implement yet, although you can run the binary directly if you desire (the compiled version for each OS can be found in the ExeFiles directory).

    I will try and get it finished for the next release (I work alone mostly unfortunately so am always trying to maximise my time!) It is fairly simple to complete though hopefully.

    Let me know if you need any further help with this.

    Best wishes,
    Matt

  • Lukas Delfin

    Hi Matt,
    I get this error:

    -bash: ./RNAfold: /lib/ld-linux.so.2: bad ELF interpreter: No such file or directory

    any idea of what might be the problem?

    Thanks!

    • The sRNA Workbench

      Hi Lukas,

      You need to install the 32bit libs for your OS (for some reason they leave these out of recent builds for linux OS)

      Do you need assistance on how to do this?

      Cheers,
      Matt

      • Lukas Delfin

        Hi Matt,
        yes please as I am getting lost :S

        L

        • The sRNA Workbench

          no worries, can you tell me exactly which operating system and version you are using?

  • Lukas Delfin

    Hi,
    I am new to Linux command line and I cannot figure out how to
    indicate default animal parameters from the command line. Where is the
    parameter file?
    Thanks a lot,

    Luca

    • The sRNA Workbench

      Hi Lukas,

      I was interested in if the binaries for the folding algorithms etc are working.

      If you cd into the ExeFiles/linux directory and then run the RNAfold program (just type ./RNAfold) and see if anything is read into the terminal and let me know?

      Cheers,
      Matt

  • Adeline

    Hi,
    I have a problem already mentioned, but I couldn’t resolve it.
    Under Ubuntu, I downloaded as recommended, the Oracle java JDK1.8 (also tried 1.7)
    java -version
    java version “1.8.0_20”
    Java(TM) SE Runtime Environment (build 1.8.0_20-b26)
    Java HotSpot(TM) 64-Bit Server VM (build 25.20-b23, mixed mode)

    When I launch sRNAWorkbenchStartup with the command : java -jar sRNAWorkbenchStartup.jar
    I see a nice window with “The UEA sRNA Workbench” and the 4 flashing nucleotides, and then, the window disappears, and this error message appears :

    Splash took too long
    memory: 70.63281 (#not always the same number)

    Any idea to help ?
    Thanks,
    Adeline

    • The sRNA Workbench

      Hi Adeline,

      Yes linux has a few issues with the startup program I think. This really just looks for free memory and assigns it to the main JVM for the program.

      You could try and launch it manually, determine how much RAM you can allocate to the workbench, lets say 5GB as an example, then type this command:

      java -Xms5g -Xmx5g -jar Workbench.jar

      into the terminal after navigating to the workbench directory and let me know if this helps.

      Cheers,
      Matt

      • Adeline

        Hi Matt,

        Thanks for your answer.

        I tried : java -Xms3584M -Xmx3584M -jar Workbench.jar (because 5G is two much for my linux computer) and got :
        UEA sRNA Workbench startup…
        Exception in thread “main” java.lang.ExceptionInInitializerError
        at uk.ac.uea.cmp.srnaworkbench.utils.Tools.(Tools.java:175)
        at uk.ac.uea.cmp.srnaworkbench.Main.startExeManager(Main.java:177)
        at uk.ac.uea.cmp.srnaworkbench.Main.main(Main.java:46)
        Caused by: java.lang.NullPointerException: Couldn’t locate project directory
        at uk.ac.uea.cmp.srnaworkbench.utils.AppPaths.(AppPaths.java:70)
        at uk.ac.uea.cmp.srnaworkbench.utils.AppPaths.(AppPaths.java:21)
        … 3 more

        I also tried on a Windows 8 computer, much more powerful, and the same command with Xmx5G (even with 100G) gave the same error message. On Windows 8 (with also JDK1.8), the command java -jar sRNAWorkbenchStartup.jar also gives the same error than on Linux, and double-clicking on UEA_sRNAWorkbench.exe has no effect.

        There seems to be compability problems between the program and some configurations…

        Cheers,
        Adeline

        • The sRNA Workbench

          Hi Adeline,

          Yes the software is untested on windows 8. I have to do some work to make it function on that OS.

          Do you have read and write permissions on the linux machine in that area? Does the software have full R/W to that area also? It is trying to create some user data directories and failing at that point it seems.

          Cheers,
          Matt

  • Mayur Divate

    Hi Matt,

    Thanks for replying my queries !

    Is there any way to mention temporary directory for and output file names for command line execution of miRCat ?

    Because I also want temp file such as patman and I have 3-4 samples so I can put it for over night one by one.

    Thank You !

  • Venkateswara Sripathi

    Hi Mat,
    Earlier, I was successful in installation and running of miRCat in Ubuntu. But recently I have reinstalled Ubuntu on my system due to some problem. Now I could not able to run miRCat properly. Please guide me in making it working.
    Same problem was getting reported again and again
    “Splash took too long
    memory: xyzz…”

    • The sRNA Workbench

      Hi,

      Can you let me know the java version? New installs of Ubuntu probably contain an unsupported version.

      Just type java -version into the console and let me know what it reports

      Cheers,
      Matt

      • yanqiao

        Hi Mat,
        I encountered the same problem in Bio-linux 7.0.
        This error messages appear in my terminal.
        “Splash took too long
        memory: 1406.625.”
        I type java -version , it reports this messages.
        “java version “1.6.0_27″
        OpenJDK Runtime Environment (IcedTea6 1.12.3) (6b27-1.12.3-0ubuntu1~12.04.1)
        OpenJDK 64-Bit Server VM (build 20.0-b12, mixed mode)”
        Could you give me some advice ?
        Thanks!
        YanQiao

        • The sRNA Workbench

          Hi,

          Unfortunately the workbench is unsupported on OpenJDK. Please change to the official Oracle build of java 1.7+ and then it should work!

          hope this helps,

          Cheers,
          Matt

  • Dominique

    Hi Matt,

    Sorry to bother you with this – I’m sure I’m doing something very simple wrong. I’m trying to launch the startup program from the command line (I’m using Windows 7 on my laptop). Have navigated to the folder but get the following message when after entering the

    java -jar sRNAWorkbenchStartup.jar
    command:

    ‘java’ is not recognized as an internal or external command, operable program or batch file.

    Thanks!
    Dominique

    • The sRNA Workbench

      Hi Dominique,

      It appears as if java is incorrectly installed or not installed at all…

      Are you using the latest version? (v3) there is a launcher that you can use to run the workbench on Windows that will take you to the location to install java from and hopefully configure all required for you.

      If not you need to visit Oracle and download then install the latest JRE http://www.oracle.com/technetwork/java/javase/downloads/index.html

      Let me know if you need any help with this install.

      Cheers,
      Matt

      • Dominique

        Hey Matt – Thanks for your quick reply and for pointing me in the right direction. I finally managed to figure out that I needed to install the Windows x64 (not Windows x86) version. I’ve done that now, and of course am now getting a different error:

        Splash took too long
        memory: 1604.4453

        I’ve tried to google this message but can’t make heads or tails of it!

        • The sRNA Workbench

          Hi Dominique,

          That message is ok, it just means that the startup program was hanging around so it shut itself down to start the workbench. Did nothing appear after this? No workbench? If you go into the folder and launch the workbench.jar or sRNAWorkbenchStartup.jar does anything appear?

          • Dominique

            Hi Matt,

            Thanks for your quick reply and sorry for my slow one. Nothing happened after I ran the command, but on your suggestion I just launched the sRNAWorkbenchStartup.jar and it is working. Thanks so much for your help!

          • The sRNA Workbench

            Hi Dominique,

            Ok great news, please feel free to let me know if you need further help with the software.

            I will look into why the wrapper program did not work on your machine. It is quite a new thing so I will run further tests on some windows machines around my department.

            Best wishes,
            Matt

          • Gracie

            same problem here with version 3.1.

            $ java -jar sRNAWorkbenchStartup.jar

            Splash took too long
            memory: 5227.1797
            and nothing else followed.

            Then tried to launch Workbench.jar, got the error message “Could not find the main class: uk.ac.uea.cmp.srnaworkbench.Main. Program will exit.”

          • The sRNA Workbench

            Hi Gracie,

            how did you try and launch the workbench.jar? Did you type

            java -jar Workbench.jar

            Alternatively,

            java -jar sRNAWorkbenchStartup.jar

            Which OS are you using by the way?

            Cheers,
            Matt

          • Felicia

            Hi Matt, I’m having the same problems. Splash took too longmemory: 412.35547
            What do I do next?

          • The sRNA Workbench

            Hi Felicia,

            Could you give me a little more information about your OS and java version? Did you try and launch the workbench directly?

            Best wishes,
            Matt

  • mingming xin

    Hi Matt, when I ran the tasiRNA prediction tool, I found all the abundance of the sRNAs are changed to one in the .patman file, I donot know why , and BTW, is there specific format for the input data? Thanks

    • The sRNA Workbench

      Hi,

      The format for input is either raw FASTA data or the non-redundant format produced by various helper tools in the workbench. It is difficult to say why the abundances were changed, could I have a look at a small sample of the exact input data? You can email it to me at matthew.stocks@uea.ac.uk

      In addition, if you directly align your data to the genome with the sequence alignment tool does the same problem occur?

  • Arjun

    Hi,

    I tried miRcat to predict new miRNAs from a sRNA file in fasta format alongwith genomic sequence file in fasta. I am running it through commandline on centOS server but getting this error:

    UEA sRNA Workbench startup…
    initial setup ok, miRCat is now processing…
    21-Jun-2013 14:06:13 uk.ac.uea.cmp.srnaworkbench.utils.LOGGERS.WorkbenchLogger log
    SEVERE: WORKBENCH: MIRCAT: Message: Connection refused;
    Stack Trace: java.net.PlainSocketImpl.socketConnect(Native Method)
    ……LOTS OF LINES

    Output of ldd patman:
    not a dynamic executable

    I would really appreciate your help.

    Awaiting reply

    Arjun

    • Hi Arjun,

      Sorry for the delay in reply I have been away on leave.

      Can I have some information about the OS you are using to run the workbench? Also some info on your system if possible.

      Best wishes,
      Matt

      • Arjun

        I am using CentOS release 6.3 (Final) Kernel 2.6.32-279.11.1.el6.x86_64. The server has 52 cores and 516 GB of RAM installed. The command I am using:

        java -Xms24g -Xmx240g -jar ~/tools/sRNAWBv3.01/Workbench.jar -tool mircat -srna_file ./R1_001_tag_count.fa -genome ./genomic_seq.fa

        Thanks for helping me. Awaiting Reply

        Arjun

        • Hi Arjun,

          The patman problem is probably the key. Sometimes this error is related to missing 32bit libs on a 64bit system.

          Can you confirm these packages are all installed?

          Cheers,
          Matt

          • Arjun

            Hi Matt,

            Which packages should I check? Awaiting your reply.

            Arjun

          • I would ensure that the 32bit runtime libraries are installed. For some reason they took these out of Centos6.

            try: yum install libstdc++.i386 to begin with…

  • Yifang

    Hi, Matt!
    Have to bug you again!
    When I was trying to switch the srna_workbench to another machine (Redhat) with ~1TB RAM, I got the same error related to patman as I met before. The strange thing is no dependency was missing for patman when I ldd patman.
    $ ldd patman
    linux-vdso.so.1 => (0x00007fffc8fff000)
    libpopt.so.0 => /lib64/libpopt.so.0 (0x00000034abc00000)
    libstdc++.so.6 => /usr/lib64/libstdc++.so.6 (0x00000034a7000000)
    libm.so.6 => /lib64/libm.so.6 (0x000000349b000000)
    libgcc_s.so.1 => /lib64/libgcc_s.so.1 (0x00000034a5800000)
    libc.so.6 => /lib64/libc.so.6 (0x000000349ac00000)
    /lib64/ld-linux-x86-64.so.2 (0x000000349a800000)

    My admin suggested I get your idea before going any further with the 32-bit libs. Here is the error log:
    $ java -Xms24g -Xmx240g -jar /home/yifang/download-software/srna-workbenchV2.4.2/Workbench.jar
    UEA sRNA Workbench startup…
    15-Nov-2012 11:08:58 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH:
    java.net.ConnectException: Connection refused
    at java.net.PlainSocketImpl.socketConnect(Native Method)
    at java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:327)
    at java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:193)
    at java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:180)
    at java.net.SocksSocketImpl.connect(SocksSocketImpl.java:384)
    at java.net.Socket.connect(Socket.java:546)
    at java.net.Socket.connect(Socket.java:495)
    at java.net.Socket.(Socket.java:392)
    at java.net.Socket.(Socket.java:206)
    at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.sendMessage(BinaryExecutor.java:217)
    at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.execPatman(BinaryExecutor.java:141)
    at uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanRunner.process(PatmanRunner.java:160)
    at uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.handleFASTAFile(Process_Hits_Patman.java:308)
    at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.processInputFile(Process_Hits_Patman.java:336)
    at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:259)
    at uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    at java.lang.Thread.run(Thread.java:679)
    15-Nov-2012 11:08:58 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: SEQ ALIGN: Message: PATMAN ERROR: Patman result file was not created: /home/yifang/download-software/srna-workbenchV2.4.2/User/temp/_0/Ath_TAIR9.fa.patman;
    Stack Trace: uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanRunner.process(PatmanRunner.java:171)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.handleFASTAFile(Process_Hits_Patman.java:308)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.processInputFile(Process_Hits_Patman.java:336)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:259)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    java.lang.Thread.run(Thread.java:679)

    15-Nov-2012 11:08:58 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: MIRCAT: Message: PATMAN ERROR: Patman result file was not created: /home/yifang/download-software/srna-workbenchV2.4.2/User/temp/_0/Ath_TAIR9.fa.patman;
    Stack Trace: uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.handleFASTAFile(Process_Hits_Patman.java:311)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.processInputFile(Process_Hits_Patman.java:336)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:259)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    java.lang.Thread.run(Thread.java:679)

    15-Nov-2012 11:10:26 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: Failed to shutdown Exe Manager
    java.net.ConnectException: Connection refused
    at java.net.PlainSocketImpl.socketConnect(Native Method)
    at java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:327)
    at java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:193)
    at java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:180)
    at java.net.SocksSocketImpl.connect(SocksSocketImpl.java:384)
    at java.net.Socket.connect(Socket.java:546)
    at java.net.Socket.connect(Socket.java:495)
    at java.net.Socket.(Socket.java:392)
    at java.net.Socket.(Socket.java:206)
    at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.stopExeManager(BinaryExecutor.java:114)
    at uk.ac.uea.cmp.srnaworkbench.utils.Tools$1.run(Tools.java:387)
    $ uname -a
    Linux yifang 2.6.32-279.el6.x86_64 #1 SMP Wed Jun 13 18:24:36 EDT 2012 x86_64 x86_64 x86_64 GNU/Linux

    Could you please give me some advice? Thanks a lot!
    Yifang

    • Hi Yifang,

      yes you are correct that you are not missing dependancies as such, however, patman is a 32bit program and all the links point to 64bit libs:

      => /lib64/libpopt.so.0 (0x00000034abc00000)

      which suggests the OS has not been able to detect the required 32bit versions of those libraries.

      These must all be installed for patman to function as I have not compiled a 64bit version of that program.

      • Yifang

        Can you please give me more information about those 32-bit libraries for patman and other programs?
        1) what are they?
        2) how to link those libs for patman/other programs to run?
        I am a novice with this issue. Thanks a lot!
        Yifang

      • Yifang

        And I tried to compile patman in my 64bit server and created a symlink to the new 64bit compiled patman, i.e. I skipped using the patman binary along with the Workbench2.4.2. That’s why all the dependancies are there, but it seems the workbenck can not be cheated! Did I miss anything? Thanks again!
        Yifang

        • Hi Yifang,

          I have emailed you a new patman binary. If you replace the binary being used by the workbench ExeFiles/linux with this one hopefully it will work for you.

          I will probably just release this with the next version if all goes well so please let me know!

          Thanks,
          Matt

          • Yifang

            No, it did not work and with the same error. Yifang

          • Hi Yifang,

            Just replying to your email about zombies.

            Your final connection error you received at the end of the procedure? Did you happen to notice if the tool had actually given the “status completed” message on the interface? It may be that it just errored while trying to shut down in which case the analysis would still be completed and usable

            Thanks,
            Matt

          • Yifang

            ” Did you happen to notice if the tool had actually given the “status completed” ”
            —No, it was “Status: failed”, and I had seen the progress going and died.
            As this new server is shared by several users, is it possible for any of the others to interfere my workbench? But I double checked they were not runing any java program at that moment. Memory was always >200GB free with max=1.3TB.
            Appreciate if you could provide any clue.
            Thanks a lot!
            Yifang

          • Hmm hard to say what caused that

            Was the connection error:

            SEVERE: WORKBENCH: Failed to shutdown Exe Manager

            the only error reported? Is there anything written into the error logs for that run?

          • Yifang

            It seems there are three types (block) of error in the log. They are”
            15214 lines of “SEVERE: WORKBENCH: java.net.ConnectException: Connection refused”
            1 line of “SEVERE: WORKBENCH: MIRCAT: Message: Connection refused”;
            89 lines of “SEVERE: WORKBENCH: Failed to shutdown Exe Manager”
            Here are the detail for each block:

            21-Nov-2012 10:36:43 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
            SEVERE: WORKBENCH: java.net.ConnectException: Connection refused
            at java.net.PlainSocketImpl.socketConnect(Native Method)
            at java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:327)
            at java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:193)
            at java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:180)
            at java.net.SocksSocketImpl.connect(SocksSocketImpl.java:384)
            at java.net.Socket.connect(Socket.java:546)
            at java.net.Socket.connect(Socket.java:495)
            at java.net.Socket.(Socket.java:392)
            at java.net.Socket.(Socket.java:206)
            at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.sendMessage(BinaryExecutor.java:217)
            at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.execRNAFold(BinaryExecutor.java:130)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.getStructure(Window.java:1363)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processSingleWindow(Window.java:741)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.processWindows(Window.java:318)
            at uk.ac.uea.cmp.srnaworkbench.tools.mircat.Window.run(Window.java:121)
            at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1110)
            at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:603)
            at java.lang.Thread.run(Thread.java:679)

            21-Nov-2012 10:37:23 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
            SEVERE: WORKBENCH: MIRCAT: Message: Connection refused;
            Stack Trace: java.net.PlainSocketImpl.socketConnect(Native Method)
            java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:327)
            java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:193)
            java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:180)
            java.net.SocksSocketImpl.connect(SocksSocketImpl.java:384)
            java.net.Socket.connect(Socket.java:546)
            java.net.Socket.connect(Socket.java:495)
            java.net.Socket.(Socket.java:392)
            java.net.Socket.(Socket.java:206)
            uk.ac.uea.cmp.exemanager.client.BinaryExecutor.stopExeManager(BinaryExecutor.java:114)
            uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.checkForMicroRNAs(Process_Hits_Patman.java:979)
            uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:287)
            uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
            java.lang.Thread.run(Thread.java:679)

            21-Nov-2012 10:37:34 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
            SEVERE: WORKBENCH: Failed to shutdown Exe Manager
            java.net.ConnectException: Connection refused
            at java.net.PlainSocketImpl.socketConnect(Native Method)
            at java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:327)
            at java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:193)
            at java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:180)
            at java.net.SocksSocketImpl.connect(SocksSocketImpl.java:384)
            at java.net.Socket.connect(Socket.java:546)
            at java.net.Socket.connect(Socket.java:495)
            at java.net.Socket.(Socket.java:392)
            at java.net.Socket.(Socket.java:206)
            at uk.ac.uea.cmp.exemanager.client.BinaryExecutor.stopExeManager(BinaryExecutor.java:114)
            at uk.ac.uea.cmp.srnaworkbench.utils.Tools$1.run(Tools.java:387)

            There are totally 320757 lines in the log file. It seems to me there are only these three blocks.
            Thanks again!
            Yifang

          • Hi Yifang,

            usually shut down errors would only occur after the procedure had completed, I have encountered these before (typically when the program attempts to close threads that are already closed) but usually if the program reaches this stage after it is complete.

            The connection errors are almost always due to zombie threads sitting on the port that miRCat wishes to use to send instructions out to external programs.

            Where you running in GUI mode or CLI? If CLI was any data written into the output directory that miRCat created? Or if GUI mode was the output table full of data at any point?

            Thanks,
            Matt

  • Yifang

    Hi, Matt!
    Another question popped up my mind while I was trying to collapse the sequence to get the non-redundant fasta file: Can I just use the longest sequence of the non-redundant fasta?
    I still have problem with the memory after I tried using only one chromosome at a time. My point is that many sequences are just substrings of the longest reads, although they are non-redundant. If only the longest sequence is used, the file size will be much smaller and the memory consumption would be greatly reduced again. Would I miss any information for the miRNA prediction and/or other analysis if I do so?
    Thank you!

    Yifang

    • Hi Yifang,

      potentially you will miss miRNA sequences as you would with many types of filtering. This is because the first part of the prediction stage is to group the small RNA sequences into genomic loci and then look at the most abundant sequences within that loci as the potential miRNA. If you remove the data then you may see less loci are formed. However, with isomirs for example they will probably all map in the same location anyway.

      The only advice I can give is to give it a go! Let me know what happens because I would be interested!

      Thanks,
      Matt

      • Yifang

        I gave it a try, no result was obtained.

        I still have problem with the memory issue. It crashed again today after 8 hours running for one sample on Ath Chr3 only. I start worrying when the analysis can be done with 6 samples like this…..
        Do you have any news for upgrade of the Workbench as you mentioned there might be a upgrade a couple of weeks ago?
        This is the best tool bundle so far I found dealing with plant sRNA.
        Thank you again!
        Yifang

        • Hi Yifang,

          Yes the upgrade is coming asap. I am looking into a way of reducing the RAM that miRCat requires because it often requires far more than I anticipated when dealing with plant data. I think some kind of disk stream rather than loading all of the small RNA loci into RAM is going to be the best way which most likely see a slow down in performance but with any luck a dramatic decrease in memory usage.

          Unfortunately I work alone on this project so things progress a little slower than I would hope! Most likely I will look to release three new versions soon, one with some bug fixes and new functionality, the next will contain the new tool for small RNA locus detection and then under the hood improvements to the memory usage depending on how fast I can create a solution.

          Dont forget to subscribe to the feed and twitter so you can be informed of these releases!

          Thanks,
          Matt

    • haishenruo

      Hi,
      I want to know if srna workbench can work on CentOS 5.7,it always remind me of this :
      Exception in thread “AWT-EventQueue-0” java.awt.HeadlessException:
      No X11 DISPLAY variable was set, but this program performed an operation which requires it.
      at java.awt.GraphicsEnvironment.checkHeadless(Unknown Source)
      at java.awt.Window.(Unknown Source)
      at java.awt.Frame.(Unknown Source)
      at java.awt.Frame.(Unknown Source)
      at javax.swing.JFrame.(Unknown Source)
      at uk.ac.uea.cmp.srnaworkbench.MainMDIWindow.(MainMDIWindow.java:53)
      at uk.ac.uea.cmp.srnaworkbench.Main$1.run(Main.java:282)
      at java.awt.event.InvocationEvent.dispatch(Unknown Source)
      at java.awt.EventQueue.dispatchEventImpl(Unknown Source)
      at java.awt.EventQueue.access$000(Unknown Source)
      at java.awt.EventQueue$3.run(Unknown Source)
      at java.awt.EventQueue$3.run(Unknown Source)
      at java.security.AccessController.doPrivileged(Native Method)
      at java.security.ProtectionDomain$1.doIntersectionPrivilege(Unknown Source)
      at java.awt.EventQueue.dispatchEvent(Unknown Source)
      at java.awt.EventDispatchThread.pumpOneEventForFilters(Unknown Source)
      at java.awt.EventDispatchThread.pumpEventsForFilter(Unknown Source)
      at java.awt.EventDispatchThread.pumpEventsForHierarchy(Unknown Source)
      at java.awt.EventDispatchThread.pumpEvents(Unknown Source)
      at java.awt.EventDispatchThread.pumpEvents(Unknown Source)
      at java.awt.EventDispatchThread.run(Unknown Source)

      • Hi,

        If you are running on a server you must have X windowing in order to forward graphics to your console.

        Which OS are you using to interface with your server? Or are you running directly on a linux desktop machine? If so it is possible you have installed a headless java version in which case you probably just need to upgrade your JVM.

        thanks,
        Matt

        • haishenruo

          Thanks Matt,
          I am running Workbench.jar on a server,I use the command cat /proc/version,it shows the information below:
          Linux version 2.6.18-274.12.1.el5 (mockbuild@builder10.centos.org) (gcc version 4.1.2 20080704 (Red Hat 4.1.2-51)) #1 SMP Tue Nov 29 13:37:46 EST 201

          and cat /etc/redhat-release ,it shows :CentOS release 5.7 (Final),then if it possibel to run the Workbench,do I need to install a X widonwing and how to ?

          • Hi,

            Your linux server “should” already have X installed. Presuming you are SSHing into the server, try and add the -X flag to your ssh command:

            ssh -X servername

            then continue as before

            You do need to have X installed on both ends though. What OS is your client machine using? If it is also Linux or mac os (lion or less, I believe they removed X from Mountain Lion until you download it) then it should have X also. If it is Windows you will need to download an X program

            Thanks,
            Matt

  • Yiang

    Thanks Matt!
    Good news, it worked thru last overnight! While I was monitoring the RAM consumption: the lowest level was less than 1GB (~600MB) left during the run, and later the free RAM came up. That implies the largest amount of RAM consumption is ~ 125GB for my 5.4Millions read on Chr1 of ATH. Anyway, it works with smaller reference, which is really good!
    One more thing I noticed was: The indicators of both Execution Stack and Completed Tasks are filled in less than five minutes, but the screen was frozen. I was guessing the mapping may have been done very quickly, but the later stage analysis like the structure drawing etc takes more RAM and time to finish, am I right? Understanding this may help me to run the perl script version so that I can pipe the analysis instead of individual run. 6 Samples x 5 chromosomes (plus ChrC and ChrM) would take a month to finish!
    I do have the non-redundant read files. Definately I will give it try, and I will let you know how it comes.
    Thank you very much again!
    Yifang

    • Thats great news. Unfortunately the Perl scripts are likely to take far longer to complete as they are single threaded processes but the workbench is multi threaded. The disparity you see between the graphics updating relating to what is happening in the software is usually because I leave drawing the interface as the least important task and if the interface is being updated over a window forwarding system there is often a fair amount of delay.

      Those indicators can fill very quickly at the beginning but change over time. This is because the progress bar on the left is filling as jobs are being added to the thread pool and the progress bar on the right indicates how many jobs have been popped from that stack and completed. Because jobs are being added to the stack at the same time as other jobs are being completed then they often fill and then empty until all small RNA loci are added to the queue. This is why the last image you see will be an empty progress bar on the right (all queued jobs have been popped from the stack) and a full progress bar on the right (all queued jobs have been completed). This is also why at all times this is an estimate of how much is still waiting to be completed (as we would have to track every processing core otherwise). Usually I see the highest peak of memory during this data structure construction stage so if you make it to this point you will hopefully be ok…

      Sorry if that is all a bit technical and not what you needed to know! Let me know if you need further details.

      In short, you may find the perl scripts take a fair amount of time longer to complete (as they are not multithreaded) but you can of course run them concurrently. I am currently working on a method to automate the procedure of splitting the analysis so that this will all be done for you in the workbench at request as I understand this is a rather laborious task. With any luck I will finish it soon and add it to my next release which fingers crossed will be available in the next couple of weeks!

      In addition, I personally would not bother running the analysis on mitochondrial or chloroplast chromosomes as you will not find any good candidates for micro RNA in that region (in my opinion at least)

      • Yiang

        Thank you Matt!
        One more question, when I use the perl script version to do the analysis with the non-redundant reads (FASTA) file, I got error.
        yifang@yt:~/download-software/srna-tools$ perl srna-tools.pl –tool mircat \
        –genome /TAIR10/chr1.fas \
        –srna_file /non-athMIR-reads/EA-reads.fa \
        –out output/EA-chr1 \
        –genomehits 5 \
        –hit_dist 100 \
        –maxgaps 4 \
        –max_overlap_length 50 \
        –max_percent_unpaired 60 \
        –max_unique_hits 4 \
        –maxsize 24 \
        –min_abundance 5 \
        –min_energy -10.0 \
        –min_gc 20 \
        –min_hairpin_len 80 \
        –min_paired 16 \
        –minsize 19 \
        –no_complex_loops \
        –percent_orientation 80 \
        –pval 0.1 \
        –trrna –window_length 100
        ————————————————————
        Uncompression of files: pre-processing_input_files
        extracting_valid_sequences
        ########################### sRNA Toolkit ERROR #########################
        An error occurred while running the job: Filtering by sequence properties, error
        while filtering sequences: The total number of valid reads and the number of
        non-redundant valid reads are equal in file srna_file. This is probably due to
        your input set having been made non-redundant before uploading. The tools on
        this site need to obtain counts for each sRNA sequence, so it is important that
        you don’t make your sequences non-redundant before uploading.
        ; File: /home/yifang/download-software/srna-tools/lib/SrnaTools/Module/FilterBySeqProperties.pm;
        Line: 193; Log-msg: –
        To see more details, either activate the ‘debug’ option in the application
        configuration file or check the error logs.
        yifang@yifang:~/download-software/srna-tools$

        For the GUI workbench you suggested using the non-redundant reads to reduce memory consumption. Did I miss anything?
        Yes, I would like to use the perl version to run several threads at the same time, hoping to finish the job sooner than 30 days!
        Thank you very much again!

        Yifang

        • Hi Yifang,

          yes the Perl scripts can only handle redundant data sets I am afraid. Only the Java based workbench can deal with non-redundant input.

          thanks,
          Matt

  • Yifang

    Hi, Matt:

    I met the same problem for the PATMAN file when running Sequence Alignment.
    “Sequence Alignment Error
    PATMAN ERRO: Patman result file was not created: /sotrage/yifang/folder-to-miRNA/test.patman”

    I have checked the libraries mentioned above: libpopt and libpopt.so.0 and they are all there (/lib/x86_64-linux-gnu/libpopt.so.0). The output ldd patman is:
    srna-workbenchV2.4.2/ExeFiles/linux$ ldd patman
    linux-gate.so.1 => (0xf77b5000)
    libpopt.so.0 => not found
    libstdc++.so.6 => not found
    libm.so.6 => /lib32/libm.so.6 (0xf7778000)
    libgcc_s.so.1 => not found
    libc.so.6 => /lib32/libc.so.6 (0xf761b000)
    /lib/ld-linux.so.2 (0xf77b6000)
    Apparently there are problems with the three libraries. How came patman could not find them? I am using Debian cluster environment with SSH access. Could you help me with this problem?
    Thanks!
    Yifang

    • Hi Yifang,

      perhaps you are missing the C runtime libraries. Try installing libstdc++ and libstdc++.i686 and then see if you get the same result with ldd.

      Thanks,
      Matt

      • Yifang

        Yes, the output for ldd patman is the same after install the libraries you mentioned. Did I miss anything? Thanks!
        Yifang

        • Ahh I see your problem now. You have installed the 64bit versions of the libraries but patman is in fact a 32bit binary. Please also install the 32bit packages and it should work for you. (The rest of the workbench is of course 64bit)

          I will look into creating a 64bit version of the patman program for a future release.

          • Tzahi Arazi

            how do you install those packages ?

          • Hi,

            well Linux used to install both versions of the libraries by default but no longer does so. You must ask for them specifically, (usually) by tagging .x86 to the end of the libraries you have requested. If you perform a yum search for the popt packages it will usually list both 32 and 64bit versions. Then simply request the x86 versions to be installed.

            Let me know if this helps,
            Matt

  • valerio

    Hi,
    I am trying to run Siloco on my sRNA data by issueing the following command:

    $ java -jar ~/srna-workbenchV2.4.2/Workbench.jar -tool siloco -srna_file_list aligned_to_hg19_rna2_003.fasta,../Sample_rna3_macino_120418_ep/aligned_to_hg19_rna3_003.fasta -genome ~/hg19/hg19.fa

    the two sRNA files are actually in fasta format (the aligned_to_hg19 in the filename only refers to the fact I filtered for sequences with alignments to hg19). The genome file is also in fasta format. I installed both libpopt0 and ia32.

    However, I still get:

    Aug 29, 2012 1:10:34 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: SEQ ALIGN: Message: PATMAN ERROR: Patman result file was not created: /home/labr9/srna-workbenchV2.4.2/User/SiLoCoData/hg19.fa.patman;
    Stack Trace: uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanRunner.process(PatmanRunner.java:171)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    java.lang.Thread.run(Thread.java:679)

    Aug 29, 2012 1:10:34 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: SILOCO: Message: /home/labr9/srna-workbenchV2.4.2/User/SiLoCoData/hg19.fa.patman (No such file or directory);
    Stack Trace: java.io.FileInputStream.open(Native Method)
    java.io.FileInputStream.(FileInputStream.java:137)
    uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanReader.process(PatmanReader.java:68)
    uk.ac.uea.cmp.srnaworkbench.tools.siloco.SiLoCoProcess.processPatmanFile(SiLoCoProcess.java:184)
    uk.ac.uea.cmp.srnaworkbench.tools.siloco.SiLoCoProcess.initialProcessing(SiLoCoProcess.java:214)
    uk.ac.uea.cmp.srnaworkbench.tools.siloco.SiLoCoProcess.process(SiLoCoProcess.java:823)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    uk.ac.uea.cmp.srnaworkbench.tools.ToolBox$7.startTool(ToolBox.java:243)
    uk.ac.uea.cmp.srnaworkbench.Main.startWorkbench(Main.java:218)
    uk.ac.uea.cmp.srnaworkbench.Main.main(Main.java:43)

    I am not familiar with patman, maybe the genome fasta file should be in some specific format? can I feed Siloco with bowtie alignments, and in case how should i edit bowtie alignements format to comply with siloco requirements?

    Thanks for your help and for providing the software!

    Valerio

    • Hi Valerio,

      Thanks for your message,

      Unfortunately I only have support for patman in the workbench at the moment, but it is causing a few problems with certain computer setups and I will be looking to include other sequence alignment programs such as bowtie as soon as possible. But as for specific formats, any FASTA genome files should be fine.

      For now though, (assuming this is a linux OS?) could you navigate to the directory holding the patman binary (/ExeFiles/linux) and run ‘ldd patman’ and let me know if it reports any other missing dependancies?

      Best wishes,
      Matthew

      • valerio

        Hi Matthew,

        thanks for the prompt response. Sorry, I did not specify, I am on a 64-bit Ubuntu machine.

        It actually looks like patman is missing libpopt:
        $ ldd patman
        linux-gate.so.1 => (0xf77c5000)
        libpopt.so.0 => not found
        libstdc++.so.6 => /usr/lib/i386-linux-gnu/libstdc++.so.6 (0xf76c1000)
        libm.so.6 => /lib/i386-linux-gnu/libm.so.6 (0xf7694000)
        libgcc_s.so.1 => /lib/i386-linux-gnu/libgcc_s.so.1 (0xf7676000)
        libc.so.6 => /lib/i386-linux-gnu/libc.so.6 (0xf74d1000)
        /lib/ld-linux.so.2 (0xf77c6000)

        However, the libpopt library is installed according to synaptic, and it is in /lib/x86-64-linux-gnu/libpopt.so.0
        I did also try a reboot, as you suggested in other posts…

        Valerio

        • Hi Valerio,

          apologies for the delay, I have been away at a conference until today so have not been up to date with all my contacts.

          Did you execute the command

          sudo apt-get install libpopt0

          ?

          Thanks,
          Matt

  • Bruno Santos

    I have tried to run mircat but when I run the command I get Aug 7, 2012 2:47:35 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: SEQ ALIGN: Message: /applications/srna-workbench/srna-workbenchV2.4.0/User/temp/_0/173_21clean.faR.fa_filtered.fa.0.chunk.patman (No such file or directory);
    Stack Trace: java.io.FileInputStream.open(Native Method)
    java.io.FileInputStream.(FileInputStream.java:106)
    uk.ac.uea.cmp.srnaworkbench.utils.FileUtils.concatFiles(FileUtils.java:436)
    uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanRunner.process(PatmanRunner.java:145)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:330)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.handleFASTAFile(Process_Hits_Patman.java:308)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.processInputFile(Process_Hits_Patman.java:336)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:259)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:330)
    uk.ac.uea.cmp.srnaworkbench.tools.ToolBox$6.startTool(ToolBox.java:207)
    uk.ac.uea.cmp.srnaworkbench.Main.startWorkbench(Main.java:218)
    uk.ac.uea.cmp.srnaworkbench.Main.main(Main.java:43)

    Now I have read your posts above but patman is producing an output and I been successfully running alignments with it on this machine so it does not seem to be the problem. Also the ldd output looks like this:

    linux-vdso.so.1 => (0x00007ffff7fff000)
    libpopt.so.0 => /lib/libpopt.so.0 (0x00007f1833c99000)
    libstdc++.so.6 => /usr/lib/x86_64-linux-gnu/libstdc++.so.6 (0x00007f1833992000)
    libm.so.6 => /lib/x86_64-linux-gnu/libm.so.6 (0x00007f183370f000)
    libgcc_s.so.1 => /lib/x86_64-linux-gnu/libgcc_s.so.1 (0x00007f18334f9000)
    libc.so.6 => /lib/x86_64-linux-gnu/libc.so.6 (0x00007f1833172000)
    /lib64/ld-linux-x86-64.so.2 (0x00007f1833eb0000)
    bacms2@node9:/applications/patman-1.2.1$

    • Hi Bruno,

      It is hard to say what is causing that, could you attempt to align the sequences to the genome using the sequence alignment tool on its own, and then run the aligned file through miRCat? As long as the filename you choose has a .patman extension it will allow the file to be loaded into miRCat.

      Could you let me know the steps you took to begin the run? (Either on here or through email is fine matthew.stocks@uea.ac.uk)

      Best wishes,
      Matt

      • Mayur Divate

        Hi Bruno,

        I faced same problem.
        I am using ubuntu OS, when start ubuntu you need to mount all the partitions.
        Unless you did not assign any name to partition ubuntu assigns sme alpha numeric name to it. if you rename the such partition where your input data and srnaWorkbench is there problem will get resolved.

        Best wishes,
        Mayur Divate

        • The sRNA Workbench

          Thanks for posting your experience! It really helps when the community can also respond with things they have found.

          Best wishes,
          Matt

  • Slava

    Hi guys,

    I’m running into a problem trying to use srna workbench ta-si prediction tool. The error seems to be related to PATMAN. Here is the error message I get:

    memory: 1583.418
    UEA sRNA Workbench startup…
    17-Apr-2012 11:56:13 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: SEQ ALIGN: Message: PATMAN ERROR: Patman result file was not created: /home/slava/src/srna-workbenchV2.3.2/User/temp/_4/test.fasta_genome_matches.patman;
    Stack Trace: uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanRunner.process(PatmanRunner.java:171)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:329)
    uk.ac.uea.cmp.srnaworkbench.tools.tasi.TasiAnalyser.process(TasiAnalyser.java:118)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:329)
    java.lang.Thread.run(Thread.java:679)

    Is there any way to fix this. Thanks a lot!

    Slava.

    • admin

      Hi all,

      This problem was related to LINUX not installing 32bit libraries by default on 64bit installs.

      Installation of ia32-libs package should hopefully solve this problem on Ubuntu Narwahl, 64bit

      Matt

      • Dadakhalandar

        Hi

        i installed ia32-libs package still i am facing the same error

        Regards
        Dadu

        • Hi Dadu,

          could you please me more specific about which error you are receiving? Does the console output still look the same as the original post?

          Thanks,
          Matt

          • Dadakhalandar

            Hii Matt

            Here is the error message which i got

            Aug 03, 2012 8:18:31 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
            SEVERE: WORKBENCH: SEQ ALIGN: Message: PATMAN ERROR: Patman result file was not created: /home/dadu/Backup/Programs/srna-workbenchV2.4.0/User/temp/_15/chrM.fa.patman;
            Stack Trace: uk.ac.uea.cmp.srnaworkbench.utils.patman.PatmanRunner.process(PatmanRunner.java:171)
            uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:330)
            uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.handleFASTAFile(Process_Hits_Patman.java:308)
            uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.processInputFile(Process_Hits_Patman.java:336)
            uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:259)
            uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:330)
            uk.ac.uea.cmp.srnaworkbench.tools.ToolBox$6.startTool(ToolBox.java:207)
            uk.ac.uea.cmp.srnaworkbench.Main.startWorkbench(Main.java:218)
            uk.ac.uea.cmp.srnaworkbench.Main.main(Main.java:43)

            Aug 03, 2012 8:18:31 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
            SEVERE: WORKBENCH: MIRCAT: Message: PATMAN ERROR: Patman result file was not created: /home/dadu/Backup/Programs/srna-workbenchV2.4.0/User/temp/_15/chrM.fa.patman;
            Stack Trace: uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.handleFASTAFile(Process_Hits_Patman.java:311)
            uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.processInputFile(Process_Hits_Patman.java:336)
            uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:259)
            uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:330)
            uk.ac.uea.cmp.srnaworkbench.tools.ToolBox$6.startTool(ToolBox.java:207)
            uk.ac.uea.cmp.srnaworkbench.Main.startWorkbench(Main.java:218)
            uk.ac.uea.cmp.srnaworkbench.Main.main(Main.java:43)

            Regards
            Dadu

          • Hi Dadu,

            Ok if you have installed the ia32 package there may be other LINUX packages missing. Which LINUX OS are you using? (Assuming UBUNTU) You will possibly be missing popt for patman to run. Try sudo apt-get install libpopt0. After this procedure is complete (and it may require a reboot) if it still does not work please navigate to the directory /ExeFiles/linux and type ldd patman. Then let me know what it reports to you.

            Thanks,
            Matt

          • Dadakhalandar

            Hiii Matt

            Thank you very much. its working now. its due to the missing of libpopt.so.0 file.

            Regards
            Dadu

  • Tzahi Arazi

    Hi all,

    Very nice software.

    one comment:

    In sRNAWorkbench 2.01 the hairpin annotation tool color the miRNA with an extra nucleotide. How do I fix this?

    Tzahi

    • admin

      Hi Tzahi,

      Thanks very much for your comment, I have identified the issue you described and fixed it in our latest version (2.2) due for release very shortly with some other new features included.

      Please subscribe to the RSS feed to receive instant notification on its availability.

      Once again, many thanks!

  • Ricardo Ramirez

    Hi,
    I’m trying to install the workbench in a cluster environment, I realised that a User folder is created the first time you launch the workbench. If several users run the workbench , will this have any side effects? Is there a way to specify the folder to be used as user folder at launch time?
    Thanks
    Ricardo.

    • admin

      Hi Ricardo,

      Version 1 does not allow for specification of a user directory at launch time, however, this functionality is included in Version 2.0

      • Yiang

        Hi Matt!
        I should have post all my questions here. Please take my apology for those questions thru other emails thu hotmail.
        Anyway, I still have problem with the analysis.
        Here is my command line I used:
        java -Xms24g -Xmx120g -jar Workbench.jar
        I was trying to use miRCat for my sRNA analysis. As you suggested, I used only one sample for one chromosome (Ath) to reduce the RAM consumption as much as poosible. My reads are 5.4Million of 229M in size in fasta format. The sequences are adaptor trimmed and cleaned with other script. Here is the head of the file:
        >seq_0_x3307200
        TCGGACCAGGCTTCATTCCCC
        >seq_3307200_x838872
        GGGATTGTAGTTCAATTGGTCAGAGCACC
        >seq_4146072_x825157
        TCCGATGTCGTCCAGCGGTTAGGATATCTGGCT
        >seq_4971229_x808751
        GGGATTGTAGTTCAATTGGTCAGAGCACCGCC
        >seq_5779980_x682892
        TCCGATGTCGTCCAGCGGTTAGGATATCTGGC
        It seems the program was working well, but became slower and slower.
        I believe it’s going to eat up all my RAM and crash again as it has taken 109GB RAM and only 16GB left on my server.
        Here are two RAM record when I monitored the progress:
        $ free -h
        total used free shared buffers cached
        Mem: 126G 105G 20G 0B 217M 42G
        -/+ buffers/cache: 63G 62G
        Swap: 0B 0B 0B
        $ free -h
        total used free shared buffers cached
        Mem: 126G 109G 16G 0B 217M 42G
        -/+ buffers/cache: 66G 59G
        Swap: 0B 0B 0B

        And here are two records from top:

        I can’t post a snapshot of the GUI screen, maybe by email for your diagnosis.
        Thank you very much again!
        Yifang

        • Yiang

          Tasks: 242 total, 1 running, 241 sleeping, 0 stopped, 0 zombie
          %Cpu(s): 74.8 us, 0.3 sy, 0.0 ni, 24.9 id, 0.0 wa, 0.0 hi, 0.0 si, 0.0 st
          MiB Mem: 129199 total, 107737 used, 21462 free, 216 buffers
          MiB Swap: 0 total, 0 used, 0 free, 43301 cached
          PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND
          29173 yifang 20 0 121g 61g 12m S 1800 48.4 594:25.56 java
          26358 yifang 20 0 21200 1780 1224 R 1 0.0 0:00.21 top
          29215 yifang 20 0 317m 19m 8928 S 0 0.0 0:03.46 java
          29365 yifang 20 0 319m 27m 9356 S 0 0.0 0:06.99 java
          …..

          These are from the log file, middle parts were omitted:

          Tasks: 243 total, 1 running, 242 sleeping, 0 stopped, 0 zombie
          %Cpu(s): 75.1 us, 0.1 sy, 0.0 ni, 24.8 id, 0.0 wa, 0.0 hi, 0.0 si, 0.0 st
          MiB Mem: 129199 total, 108541 used, 20657 free, 217 buffers
          MiB Swap: 0 total, 0 used, 0 free, 43301 cached
          PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND
          29173 yifang 20 0 121g 61g 12m S 1801 49.0 748:19.61 java
          29427 yifang 20 0 320m 28m 9360 S 0 0.0 0:08.44 java
          29520 yifang 20 0 319m 28m 9364 S 0 0.0 0:08.36 java
          29675 yifang 20 0 383m 30m 9388 S 0 0.0 0:08.28 java
          29706 yifang 20 0 321m 29m 9368 S 0 0.0 0:08.21 java

          cat workbench_info.log
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: chmod +x /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/gs
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: chmod +x /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/patman
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: chmod +x /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/RNAplot
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: chmod +x /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/RNAfold
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: chmod +x /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/randfold
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: logger already setup
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: Starting exe manager server using the following command line: “java -Xms32m -Xmx32m -jar /home/yifang/download-software/srna-workbenchV2.4.2/lib/ExeManager.jar -port 6789 -bin_path /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/ -log_path /home/yifang/download-software/srna-workbenchV2.4.2/User/logs”
          5-Nov-2012 9:55:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: Added shutdown hook to close ExeManager (port: 6,789) on exit
          5-Nov-2012 9:55:21 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: Creating tools temp data directory /home/yifang/download-software/srna-workbenchV2.4.2/User/temp/_65…created
          5-Nov-2012 9:56:49 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: MIRCAT: Starting.
          5-Nov-2012 9:57:57 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: SEQ ALIGN: Starting.
          5-Nov-2012 9:58:03 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: FILTER: Starting.
          5-Nov-2012 9:58:47 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: FILTER: Completed in: 0:00:44.608.
          5-Nov-2012 10:01:41 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: SEQ ALIGN: Completed in: 0:03:44.146.
          5-Nov-2012 10:02:02 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: logger already setup
          5-Nov-2012 10:02:02 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: Starting exe manager server using the following command line: “java -Xms32m -Xmx32m -jar /home/yifang/download-software/srna-workbenchV2.4.2/lib/ExeManager.jar -port 7789 -bin_path /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/ -log_path /home/yifang/download-software/srna-workbenchV2.4.2/User/logs”
          5-Nov-2012 10:02:02 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: logger already setup

          -Nov-2012 10:02:06 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: Starting exe manager server using the following command line: “java -Xms32m -Xmx32m -jar /home/yifang/download-software/srna-workbenchV2.4.2/lib/ExeManager.jar -port 7811 -bin_path /home/yifang/download-software/srna-workbenchV2.4.2/ExeFiles/linux/ -log_path /home/yifang/download-software/srna-workbenchV2.4.2/User/logs”

          5-Nov-2012 10:02:07 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: Added shutdown hook to close ExeManager (port: 7,811) on exit
          5-Nov-2012 11:28:04 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: no structure found
          5-Nov-2012 11:28:04 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: no structure found
          5-Nov-2012 11:28:04 AM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
          INFO: WORKBENCH: no structure found

          • Hi,

            well nothing seems to be shouting error at me so far.

            Have you executed the killall java command before running? Just to be sure there are no lingering workbench threads from a previous failed run (I have seen this happen sometimes)

        • Hi Yifang,

          There are some other options you can use to attempt to reduce the memory consumption that might help. I would suggest creating a non-redundant FASTA file through the Filter tool, then using the sequence alignment tool to align the file to each chromosome independently, you could even consider running some filtering at this point to remove reads that do not align to the genome or T/R RNA fragments. miRCat then has the ability to read the .patman files that are created through the Sequence alignment tool directly, this may help to reduce the strain on your system.

          I still think something else must be happening here because I have processed far larger files with miRCat on our server and not seen it use so much memory before. I will run some tests today with the current version and see if I have introduced a bug that is causing a leak in memory.

          Let me know how you get on!
          Thanks,
          Matt

          • Yiang

            Thanks Matt!
            Good news, it worked thru last overnight! While I was monitoring the RAM consumption: the lowest level was less than 1GB (~600MB) left during the run, and later the free RAM came up. That implies the largest amount of RAM consumption is ~ 125GB for my 5.4Millions read on Chr1 of ATH. Anyway, it works with smaller reference, which is really good!
            One more thing I noticed was: The indicators of both Execution Stack and Completed Tasks are filled in less than five minutes, but the screen was frozen. I was guessing the mapping may have been done very quickly, but the later stage analysis like the structure drawing etc takes more RAM and time to finish, am I right? Understanding this may help me to run the perl script version so that I can pipe the analysis instead of individual run. 6 Samples x 5 chromosomes (plus ChrC and ChrM) would take a month to finish!
            I do have the non-redundant read files. Definately I will give it try, and I will let you know how it comes.
            Thank you very much again!
            Yifang

A suite of tools for analysing micro RNA and other small RNA data from High-Throughput Sequencing devices