Category Archives: Software Downloads

The UEA sRNA Workbench has been tested on various platforms including:

Mac OSX (Version 10.5 Leopard; 10.6 Snow Leopard)
Linux (Ubuntu Version 10,11; CentOS Version 5, 6)
Windows 7

The small RNA Workbench Version 3.1.1

The UEA Small RNA Workbench Version 3.1.1: Released: 04/01/2014

A hot fix release for OSX version 10.8+ (Mountain Lion) and 10.9+ (Mavericks) users only. Full release notes for Version 3.1 can be found here

Download

This release fixes the issues with the original .app file created on OSX 10.7. The issue related to the security update to the OSX program known as Gatekeeper:

http://support.apple.com/kb/ht5290

This prevented the application stub launcher from working correctly. A completely new stub launcher and plist file is included in this update that should allow the software to work correctly.

IMPORTANT: First time use requires right click on the .app file, then select ‘Open’ to view this screen 

Right Click or CTRL click to show this menu
Right Click or CTRL click to show this men

when asked if you want to run the software, on this screen:Screen Shot 2014-02-04 at 14.33.23press Open.  From then on the software will be trusted and allowed to run as normal

The UEA small RNA Workbench Version 3.0

The UEA Small RNA Workbench Version 3.0: Released: 08/07/2013

Includes: A Brand New Tool for general small RNA locus detection called CoLIde! please see the following page for further details on our new tool.

Some changes to existing tools and general software updates. All details can be found below:

Download

General Behaviour Changes

  1. C++ executable wrappers for Windows!
      • No more problems with locating java on your system, the executable wrapper will scan for java and prompt an install if it is not found. Then configure the software to run without having to configure the command line path variables
  2. .dmg OSX Style package for MAC users!
  3. Users of LINUX and other operating systems must run the software in the old way until a solution to wrapping the code up presents itself…
  4. Users will now notice there are downloads per Operating System now. This is unfortunately unavoidable if we are to provide specific wrappers for the program. However, sourceforge should recognise your OS and automatically point you to the correct version to download
  5. Added code to set the locale at run time. This is to fix any problems found by people running on a machine that is using ‘,’ for decimal points

Help Files

  1. The help files have all been updated to reflect the changes made in recent versions (long overdue!) All packaged HTML files relating to tools within the Workbench should now be up to date with new screenshots of the latest interface

STARTUP PROCEDURE

  1. Some improvements to this see a time out added to the splash screen animation for people using the workbench through X window style forwarding. The screen should now run for no more than 5 seconds then proceded to fire the workbench up

HISTORY BROWSER

  1. The history browser has been modified to update records of file usage rather than adding a new record for each file that has been added. If you access the same file from the same tool only the date and time is updated. If you update the same file from a new tool, the tool name and date and time is updated. This is to prevent multiple entries of the same file path appearing in your history
  2. The date and time format has been updated to use the local date and time for the machine that is running the workbench (previously it was locked to GMT)
  3. Added a double click to the history browser table for single file quick selection
  4. Improved the time date format stamp
  5. History can now be sorted, sorts on columns one and two are lexicographical (file name and tool name) and column three is date sorted (I expect most people will use this column for sorting mainly)

Adapter Removal

  1. Files that are processed using the Adapter Removal have their file names auto generated. These files are now all added to the history log after processing has completed
  2. Added a new option to view the size class distribution as a bar chart post processing (see the Adapter Removal pages for further information)
  3. A new check box has been added to force overwriting of files that are found in the output directory that have the same auto generated name. If the check box is not selected any files that would result in an overwrite of existing data will be ignored, a message is shown to the user and the file names are added to the general workbench log
  4. Some layout modifications to fix strangeness with the max length text box
  5. Fixed a bug that was showing all length distributions as 0
  6. Fixed a bug that would add duplicate tabs if identical files were processed more than once prior to a reset

Filter

  1. Files that are processed using the Filter have their file names auto generated. These files are now all added to the history log after processing has completed
  2. A new check box has been added to force overwriting of files that are found in the output directory that have the same auto generated name. If the check box is not selected any files that would result in an overwrite of existing data will be ignored, a message is shown to the user and the file names are added to the general workbench log

COLIDE

  1. The CoLIde program now conducts the significance test on the top 4 most abundant size classes in the putative locus (previously it was always using sizes 21-24)
  2. The CoLIde program now allows users to control the amount of offset added during the calculation of the offset Chi-Square test on the size class distribution of a locus
  3. improved the layout of the result table when maximised

TASI

  1. added new parameter to change the phasing register prior to run time. A user must modify the value in the box to view phased sequences of the defined length and phase
  2. Fixed the help when running the tool from the command line. Previously it did not mention the need for a genome (you would have received an error if the file was not found though)

SiLoCo

  1. A bug in the Export to CSV functionality has been fixed. Previously the file was always opened in “append” mode meaning that if a user selected a file for overwriting the new data would in fact be appended to the file. Now the file is blanked before new writing takes place
  2. Show locus in Genome View:
    • A bug that was causing abundances of sequences that appeared in multiple samples to be summed rather than having individual values displayed has been fixed
  3. SiLoCo now features the same context functionality as CoLIde. This includes;
    • the standard arrow view genome render
    • the aggregated view genome render 
    • the output each entire selected locus to FASTA
    • the output all individual sequence each selected locus to FASTA

miRProf

  1. The issues affecting miRProfs CSV export functionality when certain grouping options were selected have been resolved.
  2. Save parameters now also includes the miRBase version and category details in the resulting .cfg file

miRCat

  1. A hopeful solution to the hanging thread problem has been included! With any luck the zombie error that many people have been experiencing after premature ends to miRCat runs will no longer be experienced
      • I am very interested to hear of any further zombie related crashes after this release. Please inform me ASAP if you have any kind of premature program end during a miRCat run that does not close all instances of java related to the workbench!
  1. Added a proper logger to the miRCat program. Activate using the check box on the parameters window. The Logger should be completely thread safe and will track all sequences examined by miRCat and tell you why they were not classified as a miRNA (or complete details if they were). File can be found in the log directory “miRCat_Info.log”
  2. miRCat show genome view now adds a tier to display the entire miRNA locus in the VisSR visualisation

VisSR

  1. Normalised abundances generated from SiLoCo and CoLIde are now displayed properly in the tooltips
  2. VisSR can now generate the aggregated view added for CoLIde directly from aligned data files produced in the sequence alignment tool
  3. VisSR now shows the complete percentage of abundances for the 100nt windows generated for the aggregate view. Percentages are formatted to 2 s.f as are all normalised abundance values
  4. The tooltips should properly reflect those abundances that are being shown as normalised or raw counts

The UEA Small RNA Workbench Version 3.01 Alpha

The UEA Small RNA Workbench Version 3.01 Alpha: Released: 21/05/2013

Please note this is the second Alpha release of Version 3.0 so we can run further tests on our new tool CoLide and provide some requested functionality. I am closing in on a stable V3.0 release with many new features and fixes that have been reported to me. When the stable release is available the final version code of the software will change to 3.0

Download

General

Added code to set the locale at run time. This is to fix any problems found by people running on a machine that is using ‘,’ for decimal points

COLIDE

  • The CoLIde program now conducts the significance test on the top 4 most abundant size classes in the putative locus (previously it was always using sizes 21-24)
  • When starting the tool after samples have been added to the correct areas, the program will analyse the data and provide the user with a bar chart of size class distributions. The top four sizes will then be displayed in a pop up window. At this point the user can continue with the auto detected values or modify them before continuing

miRCat

  • Added a new logger for testing in the miRCat program. Activate using the check box on the parameters window. The Logger should be completely thread safe and will track all sequences examined by miRCat and tell you why they were not classified as a miRNA (or complete details if they were). File can be found in the log directory “miRCat_Info.log” Once again, this is an alpha feature and may not work as intended…

The UEA Small RNA Workbench Version 3.0 Alpha

The UEA Small RNA Workbench Version 3.0 (Alpha): Released: 14/02/2013

Download

Please note this is an Alpha release of Version 3.0 so we can run some tests on our new tool. Please expect a stable release as soon as possible with further changes to other areas of the Workbench. When the stable release is available the final version code of the software will change to 3.0

Includes: A Brand New Tool for general small RNA locus detection called CoLIde! Some changes to existing tools please see the following page for further details.

The UEA Small RNA Workbench Version 2.5.0

The UEA Small RNA Workbench Version 2.5.0: Released: 13/12/2012

Download

Includes: Some changes and additions to the behaviour of certain tools in the Workbench (when running in GUI mode), some bug fixes

PLEASE NOTE: The addition of batch mode to many of the tools has changed the behaviour of many of the progress bars. Because each job to be processed is carried out in parallel it has meant that reporting each files progress is not possible (without a separate progress bar for each file). Until a better solution presents itself, the main progress bars of many batch mode tools will now inform you of which file has completed and some tools contain tabbed interfaces informing you of which files are still processing. See details below:

Sequence Alignment

  • The sequence alignment tool can now handle long read files in Windows form. Previously the workbench would only convert the short read files from windows line endings to UNIX line endings and this could cause problems in the patman output.
  • The sequence alignment tool can now output matches on either the positive or negative strand (or both) depending on the selected parameters
  • Batch mode is here! (note CLI mode is unchanged)
    • To use the tool place a list of files to be aligned into the box using the dialogs
    • The output file must now be a path to a directory where all of the aligned sequence files will be placed with the same filename as the input and _Aligned.patman appended to the end

Filter

  • Batch mode is here! (note CLI mode is unchanged)
    • To use the tool place a list of files to be aligned into the box using the dialogs
    • The output file must now be a path to a directory where all of the aligned sequence files will be placed with the same filename as the input and _Filter.fa appended to the end
    • The optional Discarded Sequences box must now also be a directory. Files will contain original file name and _Discarded.fa tagged to the end
  • The output statistics is now given in a set of tabs indexed by the filename for that sequence
    • Each tab has it’s own progress indicator. When the tab shows a green tick, that file has been completed
    • As the files are all processed in parallel they may finish processing in different orders depending on the files size
  • The maximum limit for sequence lengths has been increased to 60
  • The minimum limit for sequence lengths has been decreased to 10
  • The GUI now gives a size class distribution before and after filtering

Adapter Removal

  • Batch mode is here! (note CLI mode is unchanged)
    • The interface has had to change slightly to allow for this, users can now input a list of files into the GUI for adapter removal
    • The output box must now contain a path to a directory, each file after processing will be placed in this directory with the original file name and _AR tagged to the end
    • The optional Discarded Sequences box must now also be a directory. Files will contain original file name and _Discarded.fa tagged to the end
  • Each file to have it’s adapter trimmed still requires the same adapter sequence to be present
  • The tables are now contained in a series of tabs that will be indexed by the filename of each file that has been processed
    • Each tab has it’s own progress indicator. When the tab shows a green tick, that file has been completed
    • As the files are all processed in parallel they may finish processing in different orders depending on the files size
  • The main progress bar currently will only report how many files have been completed rather than the progress of each file being processed
  • Added a new Adapter Sequence to the pre-defined sequences

RNA Annotation

  • File load support for multiple sequence renders created from FASTA files. Primary usage is for files exported from miRCat results
  • The program will create secondary structure plots from any fasta formatted files that contain foldable RNA sequences, however, if the FASTA file is formatted in the same way as the miRCat output the miRNA and star sequence will be highlighted

The format in FASTA is as follows:

>maturemiRNA_SEQUENCE_miRNA*_SEQUENCE_CHROMOSOMEHEADER-PRECURSOR-START_COORD_END_COORD_MFE_VALUE_STRANDPLUSMINUS [Negative strand][Positive strand]

HAIRPIN

So all of the bold values will not change, and the non bold values must contain the required data. I have added an example below,

maturemiRNA: TTGAGCCGTGCCAATATCACG

miRNA*: AGATATTAGTGCGGTTCAATC

Chromosome header: “1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02”

PRECURSOR Start-End coord: 3961364, 3961453

Minimum Free Energy : -41.9

and it is on the negative strand

>maturemiRNA_TTGAGCCGTGCCAATATCACG_miRNA*_AGATATTAGTGCGGTTCAATC_1 CHROMOSOME dumped from ADB: Feb/3/09 16:9; last updated: 2009-02-02_PRECURSOR-START_3961364_END_3961453_MFE_-41.9_STRAND_- [Negative strand]
CGCGAGATATTAGTGCGGTTCAATCAAATAGTCGTCCTCTTAACTCATGGAGAACGGTGTTGTTCGATTGAGCCGTGCCAATATCACGCG

miRProf

  • Removed the weighting from the calculation of normalised values for miRProf
  • Removed the need for a genome to be supplied in order to detect miRNAs from a sRNA dataset
    • If no genome is specified the tool will conduct normalisation on total reads rather than genome matching (can be dangerous if there is contamination!)
    • A warning is shown to the user when no genome is being used
  • Completely redesigned the output of miRProf to a more useful form
    • Previously, miRProf would output (depending on grouping options):
      • miRNA code, total raw abundance (of all sequences matching miRNA code), sequences, normalised abundance over total for each sample file
    • Now it will output:
      • miRNA Code -> drop this down to reveal -> all miRNA sequences followed by the raw/normalised abundance and the number of hits each individual sequence had to the genome (if present)
    • This should allow for a far more effective identification of the most abundant miRNA sequence in your dataset, and in turn, an easier choice for selection of sequence when choosing probes in further experiment and a simple determination of differential expression over your sample set. An example of the old output and the new output is given below:
OLD (Truncated to allow text to fit on the page):
mir156 RAW: 359 NORM: 2308.38 TTGACAGAAGATAGAGAGCAC; RAW: 14 NORM: 184.15 TTGACAGAAGATAGAGAGCAC 14 972.7
NEW

mir156  Genome-Matches  S1 Raw  S2 Raw S3 Raw  S4 Raw  S1 Norm  S2 Norm  S3 Norm  S4 Norm
CTGACAGAAGATAGAGAGCAC 1 3 0 0 57 19.29 0 0 812.12
GCTCACCTCTCTTTCTGTCAGT 1 6 0 0 0 38.58 0 0 0
GCTCACTGCTCTTTCTGTCAGA 1 0 0 0 1 0 0 0 14.25
TGACAGAAGAAAGAGAGCAC 1 0 1 0 0 0 13.15 0 0
TGACAGAAGAGAGTGAGCA 6 1 0 0 0 6.43 0 0 0
TGACAGAAGAGAGTGAGCAC 6 236 4 0 19 1517.49 52.61 0 270.71
TGACAGAAGAGAGTGAGCACA 6 9 0 0 3 57.87 0 0 42.74
TGACAGAAGATAGAGAGCAC 4 2 0 0 11 12.86 0 0 156.72
TTGACAGAAGAAAGAGAGCA 1 0 0 0 1 0 0 0 14.25
TTGACAGAAGAAAGAGAGCAC 1 0 0 0 6 0 0 0 85.49
TTGACAGAAGAGAGTGAGC 1 0 0 0 1 0 0 0 14.25
TTGACAGAAGAGAGTGAGCA 1 1 0 0 1 6.43 0 0 14.25
TTGACAGAAGAGAGTGAGCAC 1 28 5 2 26 180.04 65.77 138.96 370.44
TTGACAGAAGATAGAGAGCA 3 0 0 0 3 0 0 0 42.74
TTGACAGAAGATAGAGAGCAC 3 73 4 12 203 469.39 52.61 833.74 2892.27

SiLoCo

  • Fixed a bug that was preventing users from being able to select a min_length parameter when running from the command line
  • Modified the output table to make clearer reading (chromosome, start, stop all given separate columns)
  • Fixed a bug where CLI runs where not flushing the output file correctly

miRCat

  • Added a new parameter that allows user control over how many heavy weight processing threads miRCat is allowed to generate. This will enable users to prevent miRCat from sucking up all of the CPU resources on shared systems for example
  • Reorganised the procedure for creating thread pools within miRCat in an attempt to reduce the zombie processes that are created when the program suffers a severe crash
  • Fixed a bug in the export miRNA to FASTA function that was giving incorrect data as the original abundance of the sequence in that file
  • The export hairpins function now outputs the pre-cursor sequences formated as FASTA. The header contains mature miRNA, miRNA*, chromosome header, pre-cursor start, pre-cursor end. All data is underscore separated

TASI

  • Added new functionality to output single (or multiple) loci to FASTA.
    • Highlight each row you wish to output by holding ctrl/option or shift. Then right click on the row and select the desired control
    • Single loci will output the entire sequence as FASTA that can be blasted. FASTA header will contain chromosome and start stop
  • Added new functionality to output individual small RNA (phased and unphased) from single or multiple loci
    • Highlight each row you wish to output by holding ctrl/option or shift. Then right click on the row and select the desired control
    • Each individual small RNA contains in the FASTA header: chromosome, start stop, phase or unphased, abundance and strand
  • Entire TASI result sets can be output to FASTA as individual small RNA sequences

VisSR

  • Fixed a bug that was stopping various tools from producing a render of the data if the FASTA header of the reference genome file contained spaces (affecting SiLoCo and TASI mainly)

GENERAL

  • MAC OSX users will now find there is a dock icon for the workbench rather than the standard java icon
  • A 64bit version of the patman binary has been included (for LINUX only) to help alleviate some of the problems faced during initial install

The UEA Small RNA Workbench Version 2.4.2

The UEA Small RNA Workbench Version 2.4.2: Released: 14/08/2012

Includes: Some changes to the behaviour of certain tools in the Workbench, some bug fixes, a small rebranding of the Workbench

GENERAL

  • The UEA sRNA Workbench will now be referred to as the UEA Small RNA Workbench. It is the little things that count…
  • The FASTA reading code has had it’s logging behaviour improved to assist in detection of invalid input sequences within the file. The abundance detection code is now more robust.
  • A typo in miRBase was causing the updater to crash when requesting the latest version of miRBase to be downloaded. This has now been resolved and users should once again be able to update their database from within the software
  • No more MAC OSX screen menus? I have had to disable the screen menu from the small RNA Workbench. This is because under apples code for this type of menu lies a very old rendering system that will not support any kind of enhancements to the text that can be displayed on menus. A request has come in for much more information to be given on the many acronyms used for all the tools in the Workbench to make it easier for users to decide which tool they should be loading. Until apple decide to update this area of their UI or another solution presents itself a standard menu system will be used so that I can answer this request by adding more information to the tools menu. This will not affect LINUX or Windows users
  • Many of the tools used a “go to VisSR” option on their right click menus. This has hopefully been made a little clearer to new users by replacing the text with “show genome view”

TA-SI PREDICTION

  • The show in VisSR buttons available from the right click menu and the drop down menu both opened a window showing tiers for positive and negative phased sRNAs. The bottom tier showed all sRNAs in the locus. A new tier has now been added to show only unphased sRNAs below the negative and positive. The lowest tier still reports all sRNAs within the locus
  • When using the drop down menu to show all TA-SI loci the VisSR view will now focus on the first locus in the list

VISSR

  • The tier colours were making distinguishing between which values belong to which tier difficult to identify due to the very light grey colour used for each tier. In an attempt  to address this the alternating tiers will now be coloured workbench grey. Some small changes to this colouring may occur in the future depending on feedback
  • The zoom to code was not working correctly. All tools that require focus on a particular region in the genome (such as TASI’s show in VisSR function) should now function correctly

MIRCAT

  • A bug preventing the pipeline activation from within the miRCat start new project menu has been resolved. Users should now be able to filter and trim input data using this menu.
  • Fixed a typo in miRCat output
  • miRCat GUI has been redesigned slightly to match the other tools in the Workbench. It now has standard start and cancel buttons on the main interface in the same place as the other tools. The start miRCat button has been removed from the parameter browser to reflect this
  • miRCat has some changes to it’s default parameters for animals to improve the accuracy of the prediction.
    1. minimum abundance is now 5
    2. locus distance is now 30
    3. GC content is now 30%

 

 

sRNA Workbench Version 2.4.0

sRNA Workbench Version 2.4.0: Released: 08/05/2012

Includes: a major overhaul of several internal program features, a brand new “file history” feature called the History Browser, some small bug fixes and behaviour modifications relating to all operating systems and several tools:

HISTORY BROWSER

  • a brand new feature has been added to the workbench! The History Browser allows users to easily select files that have been accessed or created by other tools in the UEA sRNA Workbench. Further information on the History Browser can be found here

MIRCAT:

  • miRCat is now able to properly scan for open ports when attempting to begin a job. The program will now simply skip over any ports that are in use when setting up a pool of threads to process a job

Adapter Removal:

  • A GUI layout issue causing the start buttons to be hidden on certain screen resolutions has been resolved

GENERAL:

  • A new video tutorial section has been added to the website! Find the tutorials for all tools here. The files required to complete the tutorials can be found here
  • A new page found here gives a brief overview of the UEA sRNA Workbench and what kind of operations it can perform including links to the tool that should be used for the required operation and the tutorial for that tool
  • Updates to the internal help pages including additional information on the non-redundant file format used in the UEA sRNA Workbench and a new page for the History Browser

Download

sRNA Workbench Version 2.3.2

sRNA Workbench Version 2.3.2: Released: 11/04/2012

Includes several bug fixes and behaviour modifications relating to all operating systems and several tools:

Adapter Removal

  • Adapter removal was inaccessible from the command line. This issue has now been resolved

miRCat:

  • miRCat was inaccessible from the command line. This issue has now been resolved
  • miRCat had an issue when creating large amounts of RNA annotation renders (when outputting to disk) potentially causing some entries in the legend to be missed. This has now been resolved
  • miRCat should now correctly output GFF records that can be read by any genome browser
  • When running miRCat from the command line, the mature miRNA sequences are now written to a file called miRNA.fa and stored in the output directory
  • When running miRCat from the command line a user no longer needs to have updated miRBase from the GUI first (however, if no miRBase files are detected then the tool will not be able to look for known miRNA sequences)

RNA annotation

  • RNA annotation was incorrectly colouring extra nt when the short sequences were overlapping the ends of the long sequences. This affected both the GUI and when activating the tool directly from miRCat, this should now work correctly
  • When rendering large amounts of hairpins to disk the hairpin tool would not show the hairpins (leaving them in the selected directory). This behaviour has been modified, the RNA annotation tool now has the ability to navigate directories of hairpin images including those generated by miRCat when rendering large amounts of results
  • Any RNA Annotation frames generated from miRCat when in file mode (i.e. when rendering large amounts of results) are locked to that specific directory and cannot have new hairpins added to them, however, new RNA annotation frames can be created in the usual way
  • A new window showing progress of RNA annotation renders from miRCat has been added
  • When rendering RNA plots directly from miRCat the colours of the highlighted regions (miRNA and miRNA*) should now match the highlighted text in the miRCat output table (blue for miRNA and red for miRNA*)
  • Rendering large amounts of hairpins has now been moved to a separate thread to prevent locking the main workbench thread
  • Hiding the sequence options in the tool will now also hide the colour palette
  • The labels in the colour chooser now change their colour to reflect the selected colour for the respective short sequence

General:

  • Changed logging level of certain messages from miRCat and RNA annotation to stop the printouts appearing in the console window when they are not needed
  • The menu system from the main window has been slightly overhauled to match the menu system on the website and in preparation for new tools coming soon

Download

sRNA Workbench Version 2.3.1

sRNA Workbench Version 2.3.1: Released: 09/03/2012

Includes bug fix (relating to a problem in Java 1.7) and small changes to two existing tools:

  • The update miRBase problem found when running the software through Java 1.7 has been temporarily worked around (as long as you are running the program from the sRNAWorkbenchStartup.jar). A more robust fix is intended for a future release but is dependant on Oracle releasing a fix for the Java Runtime Environment.
  • miRCat params, the default p-val for plants was incorrectly set at 0.5. This has now been changed to 0.05 to allow for a more accurate result set (this value can be modified through the parameter browser window)
  • SiLoCo parameter browser has gone through a slight overhaul. There is now no default for plants and animals and just one default parameters button (this made more sense)
  • SiLoCo now has no hard limit on sequence length and will allow extremely long sRNA reads to be included
  • Fixed a problem that could occasional cause a division by 0 in SiLoCo (causing strange looking output strings within the table or CSV)
  • Fixed a problem in SiLoCo that could cause a non-serious null pointer exception during repaint if the window was minimised
  • Modified the logging code because it had the potential to miss certain parts of the stack trace during an exception

Download

sRNA Workbench Version 2.3

sRNA Workbench Version 2.3: Released: 06/03/2012

Includes brand new tool!

PAREsnip a tool for detecting targets of miRNAs evidenced through the degradome using the PARE analysis technique.

The PAREsnip tool is available from the standard tools menu. For more information please visit the PAREsnip pages

and bug fixes/functional improvements to existing tools relating to several tools for all operating systems:

  • SiLoCo file select menu now allows for “appending” file names using the file open dialogue (previous version only allowed multi select of files in the same directory)
  • Entering file paths by hand should now function correctly from SiLoCo
  • Sorting columns in SiLoCo was previously incorrectly using a lexicographic sort. It now sorts columns containing pure numerical data with a numerical sort
  • SiLoCo now has an export function allowing users to export all data from the main table to CSV file for use in a spreadsheet program
  • A problem when selecting “render all hairpins” from the RNA annotation tool on MacOS was causing files not to be written under certain circumstances. This should now be working correctly
  • Timing and logging for all tools is applied to all tools in a consistent style
  • Default file filter for miRCat when starting a new project is now FASTA instead of .patman

Download