Welcome to the UEA sRNA Workbench

The UEA sRNA workbench is a simple to use, downloadable sRNA software package based on algorithms developed for the original UEA sRNA Toolkit that will perform a complete analysis of single or multiple-sample small RNA datasets from both plants and animals to identify interesting landmarks (such as detection of novel micro RNA sequences) or other tasks such as profiling small RNA expression patterns in genetic data.

For quick start instructions on using the sRNA Workbench please visit the Quick-Start pages

For a quick overview of what the UEA sRNA Workbench can do for you, and which tool you should select for the task, please visit this page.

Alternatively, a complete list of the functionality offered in the UEA sRNA Workbench and detailed help on each tool can be found at the tools pages. In addition, an extensive help menu is available from the sRNA Workbench when running in GUI mode.

No installation is required. To execute any version of the software in GUI mode simply extract all files in the zip archive and launch the sRNAWorkbenchStartup.jar program found within your extracted directory. Alternatively, you can launch separate tools from the command line following the instructions found here.

If you use the UEA sRNA Workbench in your research please visit our How To Cite Us pages

All comments are reactively moderated. We aim to accept and reply to your comments as soon as possible but please be aware there may be a delay at times. 

  • Su Melser

    Hello,
    I was wondering about the system requirements to run the software? I downloaded v3.0Alpha and have been trying to run it but I just keep running out of memory -pretty much as soon as it starts the analysis- The data set is normal size (I would guess); the small RNA fasta file is about 120MB and genome file 750MB, and I’m running with 12GB RAM, does that sound right?
    cheers
    -Su

    • The sRNA Workbench

      Hi Su,

      The alpha build of the sRNA Workbench has been replaced by a more stable version. (Version 3.1) https://sourceforge.net/projects/srnaworkbench/files/latest/download?source=navbar

      As for memory, it really depends on which tool you are using, and how you are using the workbench.

      Did you load using the sRNAWorkbenchStartup.jar (or any of the shell programs) or from Workbench.jar?, which OS are you using? In addition, did you have many other programs running at the time that might be using some of the RAM up?

      Sorry to bombard with questions but it is sometimes a little tricky to diagnose if you have run out of RAM or if there is anything we can do to allow the software to run!

      Best wishes,
      Matt

      • Su Melser

        Hi Matt,
        Sorry about that. At first we couldn’t get v3.1 to run that’s why we tried the earlier version. It was a small problem with java7 but that’s fixed and have v3.1 now. We have Windows7 Enterprise 64-bit. Here’s how we’re running it:

        Program Files (x86)/Java/jre7/bin/java.exe -jar Workbench.jar -Xmx10G -Xms1G
        UEA sRNA Workbench startup…
        Apr 04, 2014 1:30:23 PM uk.ac.uea.cmp.srnaworkbench.utils.LOGGERS.WorkbenchLogger log
        SEVERE: WORKBENCH: MIRCAT: Message: Java heap space;
        Stack Trace: java.util.Arrays.copyOf(Unknown Source)
        java.lang.AbstractStringBuilder.expandCapacity(Unknown Source)
        java.lang.AbstractStringBuilder.ensureCapacityInternal(Unknown Source)
        java.lang.AbstractStringBuilder.append(Unknown Source)
        java.lang.StringBuilder.append(Unknown Source)
        uk.ac.uea.cmp.srnaworkbench.io.FastaFileReader.processRecord(FastaFileReader.java:332)
        uk.ac.uea.cmp.srnaworkbench.io.FastaFileReader.processFile(FastaFileReader.java:185)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.openGenomeFile(Process_Hits_Patman.java:243)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.checkForMicroRNAs(Process_Hits_Patman.java:612)
        uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:328)
        uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
        java.lang.Thread.run(Unknown Source)
        Apr 04, 2014 1:30:26 PM uk.ac.uea.cmp.srnaworkbench.utils.LOGGERS.WorkbenchLogger log
        SEVERE: WORKBENCH: MIRCAT: Out of Memory Error occured.
        We advise increasing the amount of memory available to the JVM using the -Xmx argument or running smaller datasets through this machine.
        If these options are not possible then you should use a machine with more memory available to run this job.
        We also advise that you restart the UEA sRNA Workbench before running any subsequent jobs

        We don’t have anything else running at the same time. We do restart after each attempt. We thought the memory problem might come from the fact we were trying to run MirCat with a genome that’s very fragmented but we have the same problem with the latest public soybean genome (.fasta). The sRNA files are fastq.trimmed (btw is that ok?) We’ve read from the forum the workbench can run with as little as 1GB but as much as 125GB (!). Maybe our problem is simply that we need more memory?

        Thanks a lot,
        -Su

        ps. We also tried ubuntu 13.10 64-bit 12GB RAM java7 but software keeps freezing up at initial setup.

        • The sRNA Workbench

          Hi Su,

          No problem at all. Do you mean the sRNA files are still in FASTQ format or they are in FASTA? Is the data available publically? If so I can try and run through on my computer with similar RAM amounts and check if there is any issues and get back to you

          For your ubuntu machine, the java version must be the oracle build rather than the OpenJDK it comes bundled with.

          Cheers,
          Matt

          • Su Melser

            Hi Matt,
            thanks a lot, we’d be really keen to use this software we appreciate the effort in building user-friendly intuitive and accessible bioinformatics tools. We’re organizing access to one of the supercomputers here to have another go, I’ll let you know how that goes.
            Cheers
            -Su

  • Parth

    Hi,

    I am currently learning how to use PAREsnip tool. I have downloaded and installed it properly on a server. When I run the program using the command mentioned in the PAREsnip’s user guide(with appropriate input files and output file passed as parameters), my output file is empty(0KB). Therefore, I am wondering what could be the problem. I don’t get any error messages.

    Thank you for your help in advance,
    Parth.

    • The sRNA Workbench

      Hi Parth,

      It is difficult to say why exactly you got empty files. If it is ok with you I will forward this email on to the tools original designer and see if he can offer any information.

      Is the data you ran the tool on publicly available? If so I would like to know where I can retrieve it so I can try and re-create the problem you are experiencing on my end!

      Cheers,
      Matthew

      • The sRNA Workbench

        Hi Parth,

        It is a case of mixing DNA and RNA in the input files. For this program all input must be in the same format. If you can run a script over your data to replace all Us with Ts then it should work ok!

        I will add a fix for this in an upcoming version.

        Cheers for the info,
        Matt

        • Parth

          Hi Matthew,

          I see. I will try to do that and let you know how it goes.
          Thanks a lot for your help.

          Regards,
          Parth.

        • Parth

          Hi Matthew,

          I replaced all Us with Ts in the required input file, and made sure that all inputs are in the same format. It still gives me an empty output file. I attached a screenshot of last few steps that took place before the script finished executing.

          I really appreciate your help in this.

          Thanks,

          Parth.

  • The sRNA Workbench

    Hi, sorry for the delay in response I have been away at the start of the week.

    Have you tried with the tutorial data? You can download it at the same place as the workbench:

    http://sourceforge.net/project

    Use the sRNA data in FASTA/SRNAOME

    GSM154336_carrington_col0_flower_nr.fa

    and the file in the GENOME folder

    If you are getting no results with your data you could change the p-value parameter and see if that helps?

    Cheers,
    Matt

  • The sRNA Workbench

    Hi Naddo,

    Good to hear you sorted it out. Could you post what was required in case anyone else has the same issue?

    Cheers,
    Matt

  • jingjing

    Hi,

    Another question is about the result after adaptor remove:

    >GAGAGCGAGCATGAGCATGAGCAT(2)
    GAGAGCGAGCATGAGCATGAGCAT
    >AGACGGCAGGAGCAACAATATCTC(1)
    AGACGGCAGGAGCAACAATATCTC
    >TGAATCTAAATGCGGCATCTGAAT(12)
    TGAATCTAAATGCGGCATCTGAAT
    >GAGATGGAGAGTGACGAGCGAGAA(2)
    GAGATGGAGAGTGACGAGCGAGAA
    >GGGAGGGAGGAGAGAGGCGAGCGA(1)
    GGGAGGGAGGAGAGAGGCGAGCGA

    What the number mean in the title for each sequence, is it means copy number for this reads?

    Thanks!

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi,

      It is indeed, the abundance of the sequence (amount of time it was sequenced in your original data)

      This is the non-redundant data format of the workbench

      Thanks,
      Matt

  • jingjing

    Hi, I have used the adaptor Remove for my smRNA sequencing data.

    For the adaptor sequence, I select the LMN_3 in the definition: TGGAATTCTCGGGTGCCAAGG

    However, when I check the overview file in the final output, it display like this:

    Total number of sequences in input file (tomato.fastq):[total, distinct]: 504533 253426
    Sequences remaining after 3′ adaptor removal (TCGTATGC):[total, distinct]: 417024 198290
    Sequences remaining after length range filtering (16-35):[total, distinct]: 416762 198072

    As you can see that, TCGTATGC is not found on the LMN_3 adaptor sequence.

    Can you give me some suggestions?

    Thanks!

    Jingjing

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      not sure exactly what has happened there. I just ran the same data file through on my computer and got this result after selecting LMN_3:

      Total number of sequences in input file (tomato.fastq):[total, distinct]: 504533 253426
      Sequences remaining after 3′ adaptor removal (TGGAATTC):[total, distinct]: 283 127
      Sequences remaining after length range filtering (16-35):[total, distinct]: 143 93

      Then I re-ran selecting LMN_1 and got the same result as you:

      Total number of sequences in input file (tomato.fastq):[total, distinct]: 504533 253426
      Sequences remaining after 3′ adaptor removal (TCGTATGC):[total, distinct]: 417024 198290
      Sequences remaining after length range filtering (16-35):[total, distinct]: 416762 198072

      Could it be you selected the LMN_1 for this run? Or perhaps are looking at the wrong output file?

      Cheers,
      Matt

  • Ayako Mori

    Hi,

    I’m trying to analyse some sequence data through MiRCat but I keep getting the error message “The ‘sequenceId’ must be specified”. Occasionally I get the message that MiRCat can’t access the data file (“……..Access is denied”). I was wondering if you could help with this?

    Thanks,
    Ayako

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Ayako,

      Could you provide a little more information? Which OS did you use? Also, did you run the tool from the command line? Could you email me any logging information the workbench produced? (user/logs) In the same email, could I have a sample of the small RNA data you are inputting into miRCat? Also details on organism etc might help. Sorry for so many questions, it is just tough for me to track any possible reasons for this error without this kind of information

      matthew.stocks@uea.ac.uk

      best wishes,
      Matt

      • Rohit

        Hi Matt,

        I am also getting the similar error while running the miRCat. I am having a Illumina small rna library and trying to find novel miRNAs against a custom genome database (including bac clones and other genomic scaffolds).

        I am using linux version of workbench and running it on Ubuntu 12.04 version OS. I have sucessfully used it earlier for other data set similar way. I have cross checked the input read library and also genome fasta files and there is no error at all in that.

        The tool has successfully performed read filtering and alignment steps. It is even generating final patman alignment file, but it simply terminates after that with error massage “The sequnce must be specified”. Not able to tract the error at all. I need help urgently.

        Below are the last few lines from the log file:

        ….
        SEVERE: WORKBENCH: MIRCAT: Message: The ‘sequence’ must be specified;
        ….

        • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

          Comment resolved for Rohit, The error is that there are blank lines in between the FASTA headers of the genome file and the sequence which caused the program to think there is no sequence for that header.

          I will try to add some code to the FASTA reader classes that will look for these errors in the input data in future and try to resolve it.

          A simple linux/unix command to remove this spaces for you is:

          sed ‘/^$/d’ Genome.fasta > Genome2.fa

          where Genome.fasta is the original genome file

  • Nitin

    Hi Matt,
    I successfully ran the MiRCat pipeline to identify novel miRNAs in my set of species. I have a question though: I got too many miRNAs (many hundreds in some cases). Is there a way to filter down this list by using a threshold on any metric (such as MFE or Adjusted MFE) to reduce the list to a smaller one? If so, what would be a good threshold value? If not, what metric should I use to sort the list in the decreasing order of confidence that this is a real miRNA?
    Thanks,
    Nitin

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Nitin,

      Yes modifying the parameter set is essential to improve the results. You will probably have already noticed that some parameters will have an incredibly strong impact on the amount of results and some less so. It is hard to say exactly which parameter you should change to help filter your results. It is something I am working on now as part of a large scale set of changes that we will hopefully be able to include.

      Is your organism relatively new? Or are there annotations already for it? If so, the best thing you can do is to look at known miRNAs for that organism (or if none are yet known, use a close relative) and try to determine which parameters are best from the properties of those miRNA sequences (hairpin length etc). This is something that I hope to automate in the future using a selectable phylogenetic network. Do you think this would be a useful addition?

      Thanks,
      Matt

      • Nitin

        I am working on maize that has about 300 known miRNAs. So, I can certainly see how many of the known ones (or parts of them) are present in the results set. Although I was asking more along the lines of filtering the miRNA after I have generated them using a certain set of parameters: Which metric comes closest to the confidence that this is a real miRNA?
        For sure, a sensitivity analysis of the parameters will be very helpful.
        Thanks,
        Nitin

        • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

          I would say the most important factor is the abundance of the sequence. The higher it is, the more likely it is to be a miRNA. Then the presence of miRNA* is a good indicator (however the miRNA* may not have been sequenced in that sample so lack of it doesn’t necessarily mean it should be ignored). I would then consider investigating the targets of those sequences and working from there. Be warned though, we have found miRNAs before with an abundance of just 1! So abundance is not always the best indicator but if the miRNA has a valid target it will be a good place to start!

          Again, auto detection of targets is something I want to add to the tool. It just depends on if we receive enough support to continue the development…

  • Sahil

    Hi Matt,

    I have downloaded the workbench version of srna-tool kit. I wanted to use the RNA fold with Annotation tool.

    I have ~300 novel predicted pre-miRNA sequences and also corresponding mature & mature * sequences. I wanted to run toolkit for all the sequences in one go. I am able to generate hairpin structure for all the sequences in one go, but am unable to map the mature & mature* sequences on to it :( .

    Can you please help me with specific file format or other alternate way to do so using the workbench.

    Awaiting your response. Thank you.

    Sahil

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Sahil,

      This is possible, however the sequences must be in the format that miRCat uses to output hairpins.

      I added the info here but the formatting made it very difficult to read. So I added it to the release notes for the version that contained this addition:

      http://srna-workbench.cmp.uea.ac.uk/the-uea-small-rna-workbench-version-2-5-0/

      refer to the section on RNA annotation for more info!

      I hope this helps, please let me know if you need any further info or if this answers your question :)

      Cheers,
      Matt

  • Nitin

    Hi Matt,
    I am having a strange problem. I run mircat in the following way:
    java -Xms10g -Xmx20g -jar /doolittle/bin/srna-workbench/srna-workbenchV2.5.0/Workbench.jar -tool mircat -srna_file 001_fasta/4F-182BS11_Root.fa -genome /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa

    This is the error that I get:
    UEA sRNA Workbench startup…
    Apr 3, 2013 2:31:33 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH:
    java.net.ConnectException: Connection refused

    It does not create any output dir and just terminates in a a few minutes. I am running it on a remote machine via SSH with a command line.
    Please let me know what I can do to get the prg to run properly.
    Thanks,
    Nitin

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Nitin,

      It appears as if the program has zombies hanging around from a previous run. Could you please ensure you have killed all java processes related to your user name (if you have no other java programs running you can just use killall java) and then try again?

      Cheers,
      Matt

  • Antonin

    Hi Matt,
    probably you remenber me from Benasque.
    I just tried your Soft for the sRNA tools kit but I always got the same error from MirCat.
    Probably, I did some mistakes.
    See below the message from java.
    All the best
    See you
    Mar 20, 2013 4:22:57 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
    SEVERE: WORKBENCH: MIRCAT: Message: Index: 0, Size: 0;
    Stack Trace: java.util.ArrayList.rangeCheck(ArrayList.java:604)
    java.util.ArrayList.get(ArrayList.java:382)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.checkForMicroRNAs(Process_Hits_Patman.java:890)
    uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:320)
    uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
    java.lang.Thread.run(Thread.java:722)

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Antonin,

      Of course! Good to hear from you :)

      That is a difficult one to diagnose from here. Could you email me a small sample of the sRNA file you input into miRCat? Is it a.th you are working on still?

      Contact me on Matthew.stocks@uea.ac.uk

      Bw,
      Matt

      • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

        Comment resolved. For anyone else experiencing this issue, please be sure there are no zombie java processes relating to the workbench hanging around before starting the program.

        Thanks,
        Matt

  • Nitin

    Hi Matt,
    Its me again. After the command line version below did not work (as in my earlier post), I switched to the perl version. I installed the program on my remote linux box and said:

    $ srna-tools.pl –tool mircat –genome /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa –srna_file ../A635_Root.fa –out output
    Uncompression of files: pre-processing_input_files
    extracting_valid_sequences
    matching to genome
    miRCat: running miRCat pipeline (this might take a while)
    Can’t open sequence index file /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa.index: at /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Fasta.pm line 527.
    Can’t open sequence index file /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa.index: Bad file descriptor at /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Fasta.pm line 527.
    Testing: 1/3021558-3021578 GAACGTAATGACAGGAACTCT
    ########################### sRNA Toolkit ERROR #########################
    An error occurred while running the job: Sequence not found in seq DB; File:
    /doolittle/bin/srna-tools-cli/lib/SrnaTools/Module/ProcessHits.pm; Line: 735;
    Log-msg: -
    To see more details, either activate the ‘debug’ option in the application
    configuration file or check the error logs.

    Doe you know why do I get this error? There was no MaizeAGPv2.fa.index file in the dir that contained the MaizeAGPv2.fa. Does it need the index file? If so, where would that come from? Is that Bowtie index files?
    Thanks for all your help Matt!

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi,

      Sorry for the delay, I am actually out of the office on paternity leave for the next two weeks (my son was born today). You can email your perl enquiries to srna-tools@cmp.uea.ac.uk and someone will hopefully get back to you. Alternatively I can have a proper look at this (and your other comment) when I return (if I have managed to sleep!)

      Best wishes,
      Matt

      • Nitin

        Woah! Congrats Matt! Best wishes.
        I will write to srna-tools email and hopefully get a response. If I dont, I will write to this forum again.
        Take care.

  • Nitin

    Hi,
    I am having a new problem: I just upgraded from 2.4.2 to 2.5.0. I just copied the zip file to my remote linux machine and unzipped the contents. When, in the dir, I say
    $java -jar Workbench.jar -tool mircat

    It prints the following line and stays there for hours.
    UEA sRNA Workbench startup…

    When I dont even specify the tool and say java -jar Workbench.jar, it does the same.
    I am remote logging in, so I cant have the click version and have to rely on the command line. Are there any installation steps required? Are there any paths to be set in bash_profile etc?
    Thanks for any help.
    Best,
    Nitin

  • Nitin

    Hi, I remember seeing a PDF document that lists all the parameters for running command line version of miRCat. I cant seem to find it. Can you pls point me to it?
    Also, can I control control all the choices/params with the command line that are available in the GUI mode? For example, how do I choose to choose ‘yes’ to remove tRNA/sRNA etc in the command line. A PDF that lists all the names of these parameters would be very helpful. Also, an example of a parameter file would be useful.
    Thanks,
    waiting for your reply.
    Best

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi,

      All of the parameters are located in the example param files located in your install directory. Please go to data/default_params and you will find files inside that show each parameter that can be configured. Any that you do not include in the file will revert to the default.

      I believe the PDF you are referring to would relate to the original perl version of mirCAT

      http://srna-workbench.cmp.uea.ac.uk/doc/documentation.pdf

      Full details on the perl package can be found here:

      http://srna-workbench.cmp.uea.ac.uk/perl/perl_main_page.html

      I hope this helps, please feel free to leave further comment if you have any other questions

      Best wishes,
      Matt

      • Nitin

        Thanks a lot Mattew! It really helped. This doc is exactly what I was looking for.
        However, I have another issues.
        I connected to a remote server via SSH and I ran the command line version of miRCat:

        nohup java -jar Workbench.jar -tool mircat -srna_file A635_Root.fa -genome MaizeAGPv2.fa &

        And after running for a few hours, it just generated a nohup.out file filled with:

        UEA sRNA Workbench startup…
        initial setup ok, miRCat is now processing…
        Feb 6, 2013 3:50:03 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
        SEVERE: WORKBENCH:
        java.net.ConnectException: Connection refused
        …….
        Feb 6, 2013 3:50:03 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log

        I was wondering what I was doing wrong. Are there some connection issues between my machine and the remote server. I have xming running.
        Is there some way around it?
        Thanks Matthew!

        • Nitin

          Also, I just saw that somebody else also had this problem, but I could not make out anything of the solution posted.
          BTW, the only new file created is rna.ps

          there is nothing else created.
          Thanks!

          • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

            Hi,

            Well, the server program is actually residing on the client machine too, a bit weird I am sure you agree. However, it was the only solution I knew of for dealing with the issue in LINUX when working with java programs that spawn external processes swallowing up masses of system resources.

            Ok, usually the problem is caused by zombie ExeManager (the server program) hanging around after a crash or some kind of fail. Most likely it was filling your file with errors and did no processing (you do not need to redirect the output from the java tool, it will create output files automatically)

            I would suggest attempting to kill all java processes (just use killall java) and then try again. If you still get the problem let me know :)

            In addition, I noticed you did not add any memory control commands. Java usually requires the memory to be known or it just uses the default amount (memory cannot be dynamically increased to the JVM) when running through the GUI mode from the startup program this will try and do this for you but if you are going through the shell you will need to handle this yourself.

            The commands are -Xms and -Xmx (just set the value to the same amount)

            so something like java -Xms20g -Xmx20g -jar Workbench.jar -tool mircat -srna_file A635_Root.fa -genome MaizeAGPv2.fa

            would allocate 20GB of RAM to your process.

            I hope this helps,

            Thanks,
            Matt

          • Nitin

            Hi Matt,
            Thanks for the comments. I did ‘killall java -u ‘ and reran it with xms and xmx options. Like last time, it ran fine until patman, but when it came to RNAfold and java part, it started throwing same errors.
            Does this give you any more info?
            Also, do you think that running it in the perl mode would fix this issue? Although, it will take me time to install the perl command version.
            Thanks for all your help Matt! I appreciate it!

          • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

            No worries, it is why I am here :)

            Did RNAfold (and all compiled binaries) etc within the ExeFiles/linux directory gain the correct execution permission during the run? It should set them automatically but it may have failed… Also you should ensure all parts of the program has full read/write access to the working directory if possible. Apart from that it is hard to say what is causing it, you could set the program to only use one thread (should be a param called Thread_Count, it is also settable from the GUI) or alternatively running in GUI mode over X – window (if you are on a server the command when logging in is ssh -X then you will hopefully get all the graphics forwarded to your desktop) and see if the same problem occurs… I would be really interested to find out.

            It can sometimes be a bit of trouble to set things up on LINUX unfortunately.

            Sure feel free to try the Perl version, there is not alot of difference in the results but the Perl version you may find is quite a lot slower (and of course has no interaction stuff with the other tools).

          • Nitin

            Hi Matt, where is the output directory by default? Also, how can I redirect it: –out or -out?
            BTW, it does not seem to report an error when I gave it random params:
            –Thread_safsfsf 1 or –sdfsdfsf 1
            It still started running patman. I wonder if it will even read –Thread_count 1.

          • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

            ahh that is very odd, perhaps the root of the problem to be honest. It was a new thing I added in the last version to stop the program lunching every bit of system resource on our server! To be honest I only really tested it thoroughly on the GUI version (I mostly work alone on this project so testing is often a problem!) Perhaps there is something wrong with the thread count and miRCat is trying to send instructions to threads that are not there…

            I will investigate it when I get into the office :)

            The output directory for miRCat should be just next to the Workbench.jar (called Output/) when running from the command line, in the GUI mode you can select where you want the files to go with the drop down menus

          • Nitin

            Matt, an update: The program does give an output with 3 files miRNA.fa, miRNA_hairpins.txt and output.csv (which seems to have some results) inspite of all the errors. So two questions:
            1. Should I trust these results in light of the errors?
            2. How do you redirect the output to a dir: I used ‘-out mircat_out’, it still puts the results in ‘output’. Should I use ‘–out’ followed by the path of output dir?
            Thanks a bunch!
            Nitin

          • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

            It is hard to say, unfortunately, some of those errors may well have been threads that did not get executed. Basically you can trust the results that are output as being predictions but it may have missed some (imagine each potential miRNA sequence is sent to a single core for processing, if it triggered an error on that core that miRNA might be missed but the instruction is not distributed so if something was output it is most likely ok) but the results you have are probably ok.

            I dont suppose you noticed if the error happened during the run or right at the last part? Because the program itself attempts to shut all the server programs down as the last thing it does. However, sometimes if it falls out of sync it may try and close a port that is already closed. In that case you get a similar error but it is really nothing to worry about…

            Currently you cannot control where miRCat outputs from the command line (something I keep meaning to add) only from the GUI. I will add the control for it hopefully soon!

  • Priya

    Sir,
    I have a target gene sequence in Oryza sativa. Whether there are any tools available to predict the possible micro rna sequence from the target sequence containing a intron

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi,

      Do you have any 5′ RACE results that may indicate the miRNA sequence?

      To predict possible miRNAs that might target a gene is a computationally intensive procedure that will produce many false positives.
      This is the reason why our tools are based on some sort of sequencing data (mRNA seq for gene expression, sRNAseq for the existence of sRNAs, degradome, to check the cleavage). For target prediction the mRNA and sRNA information would be enough – even only with the sRNAs we could predict something, but the quality of the prediction is proportional with the quantity and quality of data that goes in.

      Or, have you checked out the rice miRNAs in miRBase? http://www.mirbase.org

      Thanks,
      Matt

  • Gopal Joshi

    Dear Sir/Ma’am,

    This is regarding the output of miRCat tool, I found that precursor shown in explorer has complete precursor sequence whereas the exported summary.csv file precursors missing 1-3 nucleotides at terminals eds of both 3′ and 5′ in some cases. It is being observed by refolding.

    Kindly provide suggestion for the same because I have to check these nucleotides in reference which is a time consuming process for high-throughput data.

    Thanks.

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Gopal Joshi,

      Is this through using the downloadable workbench or with the web based tools? I have just ran some tests on miRCat and the hairpins exported to the CSV file and the hairpins FASTA file (both through the export menu on miRCat) gave identical hairpin sequences.

      When you say shown through explorer, which files where you looking at? Did you create them through the miRCat export menus?

      Best wishes,
      Matt

      • Gopal Joshi

        Dear Mart,

        Thanks for the response…. Yes….. I have created through mRCat exports menus..

        Thanks

        • The sRNA Workbench

          Hi,

          Could you provide me with some data I could use to re-create the problem? It is not something I have seen on any data I have at the moment.

          Cheers,
          Matt

  • http://popgenie.org Nathaniel Street

    I’ve been using the tools a lot and there are two major changes I would love to see. One would be using bwa (not bowtie because bowtie can’t index a genome to size that I work on but bwa can) and the other would be for tools to re-use genome alignment results. Many of the tools have a first step of filtering and aligning input data to the reference genome and it would be great to be able to just load an already performed set of alignments.

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi,

      Yes that is an idea I have been trying to include over time. miRCat for example, can already use pre-aligned files (if they have been created with .patman for their extension and were aligned using our sequence alignment tool)

      I am working on adding these to future tools also.

      Just thought I would mention, we already have some scripts that will convert files from SAM/BAM into a format that can be used in the Workbench. I just need to convert these into java so they can be compiled into the program and then it should be fairly simple to at least support these alignments and then to actually create them also. (With any luck!)

      • http://popgenie.org Nathaniel Street

        Having SAM/BAM support would really be great. I’m very much looking forward to the next release, especially with these changes and the new loci detection tool.

        Thanks for your answers and for the continued development.

        • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

          Hi Nathan,

          No worries, the script (although written in Perl) is not too complex for handling this data so will hopefully be a quick conversion and will at least allow SAM/BAM to be used even if at first they cannot be created by the bench.

          Watch this space…

          Matt

  • Jake

    Hi, can you please direct me to documentation describing how to use these tools on the command-line? Thanks!

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Jake,

      You can find some instructions on the quickstart pages:

      http://srna-workbench.cmp.uea.ac.uk/quick-start/

      if you need further information please dont hesitate to ask.

      Thanks,
      Matt

      • Jake

        Fantastic, you guys make it too easy! Thanks.

  • Marius

    Hi Matt,

    The closest I have to an alignment tool is CLC genomics workbench. Is there a specific file-type I must use (extension)?

    Thanx,
    Marius

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Marius,

      It needs to be created by the sequence alignment tool in the workbench, you will find it under the helper tools menu. The aligned sequences must be in this format to be used by miRCat.

      by the way, dont worry if the reply button does not appear at some point, there is limit on the replies to each post. Just start a new comment if necessary :)

      Thanks,
      Matt

      • Marius

        Okay, that sounds pretty straightforward.
        Thanx and let’s see.

        • Marius

          Hi Matt,

          I’ve repeated miRCat analysis on a Windows 7 OS 8Gb RAM machine and again an “out of memory error” message appeared. It tells me to enlarge JVM memory. When I run the analysis, however, without selecting plant or animal parameters it does start working.. Would it help getting Java 7 64bit, because it is not installed?

          Thanx,
          Marius

          • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

            Hi Marius,

            Yes you must use 64bit Java because 32bit programs are all restricted to a maximum of 2GB of RAM (regardless of programming language). If you want to check which java version you have then type java -version into the command line (dos prompt) which can be loaded by typing cmd into the run menu on the Windows7 start bar.

            Thanks,
            Matt

          • Marius

            Hi Matt,

            Java 7 64bit is installed on the 8Gb machine, but the program still runs out of memory. What can I do to make it work?

            Marius

          • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

            Hi Marius,

            Unfortunately miRCat is currently rather intensive on memory, more than I would have hoped. I am working on a way of decreasing the footprint but it is not ready yet. You may find that changing the parameter settings for your data will decrease the amount of memory you use (particularly settings such as the minimum abundance to be considered, if you set this higher then less small RNAs will be used but of course this will decrease the sensitivity of your result set).

            If you use the .patman file you created with the sequence alignment tool you may find this process is a little faster.

            The other option is to split the analysis up by aligning to single chromosomes or portions of the genome with the sequence alignment tool (and a set of reduced genome files) and using each of these in a separate analysis. This of course means a little more work at your end. Again I am looking into ways of automating this procedure.

            I would also recommend ensuring your computer is not running any other intensive programs before you launch the workbench (such as web browsers) as the program will use only the RAM it finds available (i.e total RAM – what ever is being used).

            I hope this helps,
            Matt

    • Marius

      Matt,

      Actually just realized that I have BAM files for each sample. I can’t see where in mircat I can import these?

      Marius

      • Marius

        Hi Matt,

        I just got an “out of memory error” message with the newly created patman file. I don’t know what to do now. I’ll see if I can find a computer with more RAM. I have 4Gb of RAM. Unless you have another solution for me?

        Cheers,
        Marius

        • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

          Hi Marius,

          4GB of RAM may not be enough to complete your analysis, you can either use a bigger machine or have you considered using iPlant? It is a cloud based service hosted in the US:

          http://www.iplantcollaborative.org/

          They have the Workbench installed on their cluster and creating an account to use it is free. There are many different analysis tools you can use. When logging in and selecting the workbench you will be presented with a virtual desktop that you can then launch the Workbench from. They will only give you 4GB of RAM to begin with but you can request more through email (I think they will give you 32GB if you ask) and I think the default storage allowance is 10GB (you may need more depending on the size of your dataset.

          It is a bit of an effort to set it up and transfer your data to their cloud but once you have done it you can then continue to use it for further analysis.

  • Iain

    miRcat does not work on tqo different MAC desktops (operating systems 10.7.5). Installation appears fine however when miRCat fails to produce an output file. The output, “successfully completed”, is observed however there is no data. The exactly same files (sRNA and genome sequence) and sRNA tools version were downloaded onto another Mac (10.6.8) and it works as expected

    • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

      Hi Iain,

      That is very strange. I am running MAC OS 10.7.5 as my main development platform and have not experienced any differences as yet. Can you confirm which version of Java you are using? Also are the spec of the two machines (hardware) the same?

      Edit: Just noticed you wrote sRNA tools rather than Workbench. Can you confirm this post relates to the sRNA Workbench (Java) or the tools (Perl)?

      Thanks,
      Matt

      • Iain

        Java version- 1.6.0_37 Build 110613 . Confirm problem is with Workbench.

        • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

          Hi Iain,

          I have run further tests with miRCat today and still find no differences when running data through my main Lion machine and an older Snow leopard install. Could you zip up the log files for me (User/logs) and send them to matthew.stocks@uea.ac.uk

          Perhaps they will shed some light as to what is happening on your machine.

          Thanks,
          Matt

  • Chintan Vora

    Can you explain me the output of Plant target prediction tool?

    • admin

      Hi,

      There is a full pdf of documentation for the downloadable srna-toolkit. The scripts are pretty much the same as the ones being run on the web-based version. There is a chapter on the original plant target prediction tool that should hopefully explain the output a little better. You can find the pdf here:

      http://srna-workbench.cmp.uea.ac.uk/doc/documentation.pdf

  • Chintan Vora

    In the UEA sRNA toolkit plant version the plant target prediction tool uses target finder as back hand tool for target prediction for plants?

  • Tzahi Arazi

    Why is the hairpin GFF file cannot be viewed by VSR or any other genome viewers ?

  • Tzahi Arazi

    Please not that in version 2.3.1 still the rendering of the hairpin is wrong coloring an extra base in the 5 prime of the miRNA and miRNA star. Can you fix this ?

    Thanks
    Tzahi

    • admin

      Hi Tzahi,

      we are currently looking into this issue and will attempt to get it fully functional for our next release. Thanks for the report.

  • Chintan Vora

    How does sRNA workbench calculate normalised count for organisms other than the reference genome provided? Does it work on homology basis?

    • admin

      In SiLoCo we normalise using genome matching reads (per-total). In the next version we will be able to perform normalisation on all reads (with and without a genome) using various new methods.

      • Chintan Vora

        How does miRprof calculate normalised count for organisms other than the reference genome provided? Does it work on homology basis?

        • admin

          miRProf calculates normalised counts in the same way as SiLoCo (see reply above)

          • Chintan Vora

            Ya i got it.Thank you

  • Chintan Vora

    Can we find differentially expressed miRNA’s using sRNA workbench?
    For example if we want to compare expression of 2 miRNA samples(control and treated). Is it possible to get list of up regulated and down regulated miRNA’s?

    • admin

      Currently we are developing a new tool to be added into the Workbench called FiRePat (Finding Regulatory Patterns) which we aim to release in the near future. In this tool we will implement the current methods for determining differentially expressed sRNA in multiple sample experiments.

      A web based version of FiRePat is currently available from our original tools website (http://srna-tools.cmp.uea.ac.uk)

      I will add a post to the feed when the new tool is available.

  • Chintan Vora

    Will this tool work for SOLiD small RNA data?

    • admin

      Hi,

      Unfortunately not, it is something we intend on looking into for the future, but there are several issues that would require considerable work to make the software work directly on SOLiD data.

      We currently recommend converting the data into base space in order to use these tools but we have not tested this method (I am aware that they may be several issues with this kind of conversion!)

      Please feel free to contact me for any further information.
      Matt

      • Chintan Vora

        Thank you for the information it was very useful

        • admin

          No problem :) We are running some tests on a workaround solution as we speak and with any luck will put out a small release in the next few hours that will allow the workbench to run on Java 1.7

          Thanks,
          Matt

  • http://www.xcelrisgenomics.com Chintan

    Hi,

    I have a small RNA data set of illumina.
    I am not able to update the miRBase database files.
    So please guide me in solving this problem.

    Can you also explain when and how is miRBase being used?

    Regards,
    Chintan Vora

    • admin

      Hi,

      you may be experiencing an issue related to Java 1.7 when attempting to download/update miRBase files (related to support for IPv4, Java are aware of the problem but I am not sure when their updated code will be available). We are attempting to add a work-around at the moment.

      The software should work fine on Java 1.6 (any update). If you want instruction on how to use an earlier version of Java please let me know.

      miRBase is used for miRProf to determine known miRNA within your sRNA datasets. It is also used in miRCat to inform you of any predicted miRNA that are already found in miRBase.

      I hope this helps,
      Matt

      • Marius

        Dear Matt,

        I am currently having problems in mircat. After loading my .fa sample file and genome file and start the run, an error message appears telling me that it “system cannot find vvi12x.fa.patman file”… I don’t get this since the file’s name is “vvi12x.fa” and I specifically choose to open a FASTA file extension. Can you please assist/help me out to overcome this problem.

        Kind regards,
        Marius

        • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

          Hi Marius,

          could you let me know which OS you are using?

          Thanks,
          Matt

          • Marius

            Hi Matt,

            I’m using a Windows 7 64bit machine. Earlier it seemed like mircat actually started running, but it went on for an hour without progress (progress bars stayed empty).

            Marius

          • http://srna-workbench.cmp.uea.ac.uk/ M.B.Stocks

            Hi Marius,

            could you attempt to align the small RNA sequences to the genome using the sequence alignment tool? You can use the files it produces directly within miRCat and that will tell me if there was a problem executing patman.

            Thanks,
            Matt

A suite of tools for analysing micro RNA and other small RNA data from High-Throughput Sequencing devices