The UEA sRNA workbench is a new simple to use, downloadable sRNA software package based on algorithms developed for the original UEA sRNA Toolkit that will perform a complete analysis of single or multiple-sample sRNA datasets from both plants and animals to identify interesting landmarks (such as detection of novel micro RNA sequences) or other tasks such as profiling small RNA expression patterns in genetic data.
For quick start instructions on using the sRNA Workbench please visit the Quick-Start pages
For a quick overview on what the UEA sRNA Workbench can do for you, and which tool you should select for the task then please visit this page.
Alternatively, a complete list of the functionality offered in the UEA sRNA Workbench and detailed help on each tool can be found at the tools pages. In addition, an extensive help menu is available from the sRNA Workbench when running in GUI mode.
No installation is required. To execute any version of the software in GUI mode simply extract all files in the zip archive and launch the sRNAWorkbenchStartup.jar program found within your extracted directory. Alternatively, you can launch separate tools from the command line following the instructions found here.

Hi,
I’m trying to analyse some sequence data through MiRCat but I keep getting the error message “The ‘sequenceId’ must be specified”. Occasionally I get the message that MiRCat can’t access the data file (“……..Access is denied”). I was wondering if you could help with this?
Thanks,
Ayako
Hi Ayako,
Could you provide a little more information? Which OS did you use? Also, did you run the tool from the command line? Could you email me any logging information the workbench produced? (user/logs) In the same email, could I have a sample of the small RNA data you are inputting into miRCat? Also details on organism etc might help. Sorry for so many questions, it is just tough for me to track any possible reasons for this error without this kind of information
matthew.stocks@uea.ac.uk
best wishes,
Matt
Hi Matt,
I am also getting the similar error while running the miRCat. I am having a Illumina small rna library and trying to find novel miRNAs against a custom genome database (including bac clones and other genomic scaffolds).
I am using linux version of workbench and running it on Ubuntu 12.04 version OS. I have sucessfully used it earlier for other data set similar way. I have cross checked the input read library and also genome fasta files and there is no error at all in that.
The tool has successfully performed read filtering and alignment steps. It is even generating final patman alignment file, but it simply terminates after that with error massage “The sequnce must be specified”. Not able to tract the error at all. I need help urgently.
Below are the last few lines from the log file:
….
SEVERE: WORKBENCH: MIRCAT: Message: The ‘sequence’ must be specified;
….
Comment resolved for Rohit, The error is that there are blank lines in between the FASTA headers of the genome file and the sequence which caused the program to think there is no sequence for that header.
I will try to add some code to the FASTA reader classes that will look for these errors in the input data in future and try to resolve it.
A simple linux/unix command to remove this spaces for you is:
sed ‘/^$/d’ Genome.fasta > Genome2.fa
where Genome.fasta is the original genome file
Hi Matt,
I successfully ran the MiRCat pipeline to identify novel miRNAs in my set of species. I have a question though: I got too many miRNAs (many hundreds in some cases). Is there a way to filter down this list by using a threshold on any metric (such as MFE or Adjusted MFE) to reduce the list to a smaller one? If so, what would be a good threshold value? If not, what metric should I use to sort the list in the decreasing order of confidence that this is a real miRNA?
Thanks,
Nitin
Hi Nitin,
Yes modifying the parameter set is essential to improve the results. You will probably have already noticed that some parameters will have an incredibly strong impact on the amount of results and some less so. It is hard to say exactly which parameter you should change to help filter your results. It is something I am working on now as part of a large scale set of changes that we will hopefully be able to include.
Is your organism relatively new? Or are there annotations already for it? If so, the best thing you can do is to look at known miRNAs for that organism (or if none are yet known, use a close relative) and try to determine which parameters are best from the properties of those miRNA sequences (hairpin length etc). This is something that I hope to automate in the future using a selectable phylogenetic network. Do you think this would be a useful addition?
Thanks,
Matt
I am working on maize that has about 300 known miRNAs. So, I can certainly see how many of the known ones (or parts of them) are present in the results set. Although I was asking more along the lines of filtering the miRNA after I have generated them using a certain set of parameters: Which metric comes closest to the confidence that this is a real miRNA?
For sure, a sensitivity analysis of the parameters will be very helpful.
Thanks,
Nitin
I would say the most important factor is the abundance of the sequence. The higher it is, the more likely it is to be a miRNA. Then the presence of miRNA* is a good indicator (however the miRNA* may not have been sequenced in that sample so lack of it doesn’t necessarily mean it should be ignored). I would then consider investigating the targets of those sequences and working from there. Be warned though, we have found miRNAs before with an abundance of just 1! So abundance is not always the best indicator but if the miRNA has a valid target it will be a good place to start!
Again, auto detection of targets is something I want to add to the tool. It just depends on if we receive enough support to continue the development…
Hi Matt,
I have downloaded the workbench version of srna-tool kit. I wanted to use the RNA fold with Annotation tool.
I have ~300 novel predicted pre-miRNA sequences and also corresponding mature & mature * sequences. I wanted to run toolkit for all the sequences in one go. I am able to generate hairpin structure for all the sequences in one go, but am unable to map the mature & mature* sequences on to it
.
Can you please help me with specific file format or other alternate way to do so using the workbench.
Awaiting your response. Thank you.
Sahil
Hi Sahil,
This is possible, however the sequences must be in the format that miRCat uses to output hairpins.
I added the info here but the formatting made it very difficult to read. So I added it to the release notes for the version that contained this addition:
http://srna-workbench.cmp.uea.ac.uk/the-uea-small-rna-workbench-version-2-5-0/
refer to the section on RNA annotation for more info!
I hope this helps, please let me know if you need any further info or if this answers your question
Cheers,
Matt
Hi Matt,
I am having a strange problem. I run mircat in the following way:
java -Xms10g -Xmx20g -jar /doolittle/bin/srna-workbench/srna-workbenchV2.5.0/Workbench.jar -tool mircat -srna_file 001_fasta/4F-182BS11_Root.fa -genome /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa
This is the error that I get:
UEA sRNA Workbench startup…
Apr 3, 2013 2:31:33 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
SEVERE: WORKBENCH:
java.net.ConnectException: Connection refused
…
It does not create any output dir and just terminates in a a few minutes. I am running it on a remote machine via SSH with a command line.
Please let me know what I can do to get the prg to run properly.
Thanks,
Nitin
Hi Nitin,
It appears as if the program has zombies hanging around from a previous run. Could you please ensure you have killed all java processes related to your user name (if you have no other java programs running you can just use killall java) and then try again?
Cheers,
Matt
Hi Matt,
probably you remenber me from Benasque.
I just tried your Soft for the sRNA tools kit but I always got the same error from MirCat.
Probably, I did some mistakes.
See below the message from java.
All the best
See you
Mar 20, 2013 4:22:57 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
SEVERE: WORKBENCH: MIRCAT: Message: Index: 0, Size: 0;
Stack Trace: java.util.ArrayList.rangeCheck(ArrayList.java:604)
java.util.ArrayList.get(ArrayList.java:382)
uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.checkForMicroRNAs(Process_Hits_Patman.java:890)
uk.ac.uea.cmp.srnaworkbench.tools.mircat.Process_Hits_Patman.process(Process_Hits_Patman.java:320)
uk.ac.uea.cmp.srnaworkbench.tools.RunnableTool.run(RunnableTool.java:339)
java.lang.Thread.run(Thread.java:722)
Hi Antonin,
Of course! Good to hear from you
That is a difficult one to diagnose from here. Could you email me a small sample of the sRNA file you input into miRCat? Is it a.th you are working on still?
Contact me on Matthew.stocks@uea.ac.uk
Bw,
Matt
Comment resolved. For anyone else experiencing this issue, please be sure there are no zombie java processes relating to the workbench hanging around before starting the program.
Thanks,
Matt
Hi Matt,
Its me again. After the command line version below did not work (as in my earlier post), I switched to the perl version. I installed the program on my remote linux box and said:
$ srna-tools.pl –tool mircat –genome /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa –srna_file ../A635_Root.fa –out output
Uncompression of files: pre-processing_input_files
extracting_valid_sequences
matching to genome
miRCat: running miRCat pipeline (this might take a while)
Can’t open sequence index file /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa.index: at /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Fasta.pm line 527.
Can’t open sequence index file /doolittle/Genomes/Zea_mays/AGPv2/sequence/MaizeAGPv2.fa.index: Bad file descriptor at /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Fasta.pm line 527.
Testing: 1/3021558-3021578 GAACGTAATGACAGGAACTCT
########################### sRNA Toolkit ERROR #########################
An error occurred while running the job: Sequence not found in seq DB; File:
/doolittle/bin/srna-tools-cli/lib/SrnaTools/Module/ProcessHits.pm; Line: 735;
Log-msg: -
To see more details, either activate the ‘debug’ option in the application
configuration file or check the error logs.
Doe you know why do I get this error? There was no MaizeAGPv2.fa.index file in the dir that contained the MaizeAGPv2.fa. Does it need the index file? If so, where would that come from? Is that Bowtie index files?
Thanks for all your help Matt!
Hi,
Sorry for the delay, I am actually out of the office on paternity leave for the next two weeks (my son was born today). You can email your perl enquiries to srna-tools@cmp.uea.ac.uk and someone will hopefully get back to you. Alternatively I can have a proper look at this (and your other comment) when I return (if I have managed to sleep!)
Best wishes,
Matt
Woah! Congrats Matt! Best wishes.
I will write to srna-tools email and hopefully get a response. If I dont, I will write to this forum again.
Take care.
Hi,
I am having a new problem: I just upgraded from 2.4.2 to 2.5.0. I just copied the zip file to my remote linux machine and unzipped the contents. When, in the dir, I say
$java -jar Workbench.jar -tool mircat
It prints the following line and stays there for hours.
UEA sRNA Workbench startup…
When I dont even specify the tool and say java -jar Workbench.jar, it does the same.
I am remote logging in, so I cant have the click version and have to rely on the command line. Are there any installation steps required? Are there any paths to be set in bash_profile etc?
Thanks for any help.
Best,
Nitin
Hi, I remember seeing a PDF document that lists all the parameters for running command line version of miRCat. I cant seem to find it. Can you pls point me to it?
Also, can I control control all the choices/params with the command line that are available in the GUI mode? For example, how do I choose to choose ‘yes’ to remove tRNA/sRNA etc in the command line. A PDF that lists all the names of these parameters would be very helpful. Also, an example of a parameter file would be useful.
Thanks,
waiting for your reply.
Best
Hi,
All of the parameters are located in the example param files located in your install directory. Please go to data/default_params and you will find files inside that show each parameter that can be configured. Any that you do not include in the file will revert to the default.
I believe the PDF you are referring to would relate to the original perl version of mirCAT
http://srna-workbench.cmp.uea.ac.uk/doc/documentation.pdf
Full details on the perl package can be found here:
http://srna-workbench.cmp.uea.ac.uk/perl/perl_main_page.html
I hope this helps, please feel free to leave further comment if you have any other questions
Best wishes,
Matt
Thanks a lot Mattew! It really helped. This doc is exactly what I was looking for.
However, I have another issues.
I connected to a remote server via SSH and I ran the command line version of miRCat:
nohup java -jar Workbench.jar -tool mircat -srna_file A635_Root.fa -genome MaizeAGPv2.fa &
And after running for a few hours, it just generated a nohup.out file filled with:
UEA sRNA Workbench startup…
initial setup ok, miRCat is now processing…
Feb 6, 2013 3:50:03 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
SEVERE: WORKBENCH:
java.net.ConnectException: Connection refused
…….
Feb 6, 2013 3:50:03 PM uk.ac.uea.cmp.srnaworkbench.utils.WorkbenchLogger log
I was wondering what I was doing wrong. Are there some connection issues between my machine and the remote server. I have xming running.
Is there some way around it?
Thanks Matthew!
Also, I just saw that somebody else also had this problem, but I could not make out anything of the solution posted.
BTW, the only new file created is rna.ps
there is nothing else created.
Thanks!
Hi,
Well, the server program is actually residing on the client machine too, a bit weird I am sure you agree. However, it was the only solution I knew of for dealing with the issue in LINUX when working with java programs that spawn external processes swallowing up masses of system resources.
Ok, usually the problem is caused by zombie ExeManager (the server program) hanging around after a crash or some kind of fail. Most likely it was filling your file with errors and did no processing (you do not need to redirect the output from the java tool, it will create output files automatically)
I would suggest attempting to kill all java processes (just use killall java) and then try again. If you still get the problem let me know
In addition, I noticed you did not add any memory control commands. Java usually requires the memory to be known or it just uses the default amount (memory cannot be dynamically increased to the JVM) when running through the GUI mode from the startup program this will try and do this for you but if you are going through the shell you will need to handle this yourself.
The commands are -Xms and -Xmx (just set the value to the same amount)
so something like java -Xms20g -Xmx20g -jar Workbench.jar -tool mircat -srna_file A635_Root.fa -genome MaizeAGPv2.fa
would allocate 20GB of RAM to your process.
I hope this helps,
Thanks,
Matt
Hi Matt,
Thanks for the comments. I did ‘killall java -u ‘ and reran it with xms and xmx options. Like last time, it ran fine until patman, but when it came to RNAfold and java part, it started throwing same errors.
Does this give you any more info?
Also, do you think that running it in the perl mode would fix this issue? Although, it will take me time to install the perl command version.
Thanks for all your help Matt! I appreciate it!
No worries, it is why I am here
Did RNAfold (and all compiled binaries) etc within the ExeFiles/linux directory gain the correct execution permission during the run? It should set them automatically but it may have failed… Also you should ensure all parts of the program has full read/write access to the working directory if possible. Apart from that it is hard to say what is causing it, you could set the program to only use one thread (should be a param called Thread_Count, it is also settable from the GUI) or alternatively running in GUI mode over X – window (if you are on a server the command when logging in is ssh -X then you will hopefully get all the graphics forwarded to your desktop) and see if the same problem occurs… I would be really interested to find out.
It can sometimes be a bit of trouble to set things up on LINUX unfortunately.
Sure feel free to try the Perl version, there is not alot of difference in the results but the Perl version you may find is quite a lot slower (and of course has no interaction stuff with the other tools).
Hi Matt, where is the output directory by default? Also, how can I redirect it: –out or -out?
BTW, it does not seem to report an error when I gave it random params:
–Thread_safsfsf 1 or –sdfsdfsf 1
It still started running patman. I wonder if it will even read –Thread_count 1.
ahh that is very odd, perhaps the root of the problem to be honest. It was a new thing I added in the last version to stop the program lunching every bit of system resource on our server! To be honest I only really tested it thoroughly on the GUI version (I mostly work alone on this project so testing is often a problem!) Perhaps there is something wrong with the thread count and miRCat is trying to send instructions to threads that are not there…
I will investigate it when I get into the office
The output directory for miRCat should be just next to the Workbench.jar (called Output/) when running from the command line, in the GUI mode you can select where you want the files to go with the drop down menus
Matt, an update: The program does give an output with 3 files miRNA.fa, miRNA_hairpins.txt and output.csv (which seems to have some results) inspite of all the errors. So two questions:
1. Should I trust these results in light of the errors?
2. How do you redirect the output to a dir: I used ‘-out mircat_out’, it still puts the results in ‘output’. Should I use ‘–out’ followed by the path of output dir?
Thanks a bunch!
Nitin
It is hard to say, unfortunately, some of those errors may well have been threads that did not get executed. Basically you can trust the results that are output as being predictions but it may have missed some (imagine each potential miRNA sequence is sent to a single core for processing, if it triggered an error on that core that miRNA might be missed but the instruction is not distributed so if something was output it is most likely ok) but the results you have are probably ok.
I dont suppose you noticed if the error happened during the run or right at the last part? Because the program itself attempts to shut all the server programs down as the last thing it does. However, sometimes if it falls out of sync it may try and close a port that is already closed. In that case you get a similar error but it is really nothing to worry about…
Currently you cannot control where miRCat outputs from the command line (something I keep meaning to add) only from the GUI. I will add the control for it hopefully soon!
Sir,
I have a target gene sequence in Oryza sativa. Whether there are any tools available to predict the possible micro rna sequence from the target sequence containing a intron
Hi,
Do you have any 5′ RACE results that may indicate the miRNA sequence?
To predict possible miRNAs that might target a gene is a computationally intensive procedure that will produce many false positives.
This is the reason why our tools are based on some sort of sequencing data (mRNA seq for gene expression, sRNAseq for the existence of sRNAs, degradome, to check the cleavage). For target prediction the mRNA and sRNA information would be enough – even only with the sRNAs we could predict something, but the quality of the prediction is proportional with the quantity and quality of data that goes in.
Or, have you checked out the rice miRNAs in miRBase? http://www.mirbase.org
Thanks,
Matt
Dear Sir/Ma’am,
This is regarding the output of miRCat tool, I found that precursor shown in explorer has complete precursor sequence whereas the exported summary.csv file precursors missing 1-3 nucleotides at terminals eds of both 3′ and 5′ in some cases. It is being observed by refolding.
Kindly provide suggestion for the same because I have to check these nucleotides in reference which is a time consuming process for high-throughput data.
Thanks.
Hi Gopal Joshi,
Is this through using the downloadable workbench or with the web based tools? I have just ran some tests on miRCat and the hairpins exported to the CSV file and the hairpins FASTA file (both through the export menu on miRCat) gave identical hairpin sequences.
When you say shown through explorer, which files where you looking at? Did you create them through the miRCat export menus?
Best wishes,
Matt
I’ve been using the tools a lot and there are two major changes I would love to see. One would be using bwa (not bowtie because bowtie can’t index a genome to size that I work on but bwa can) and the other would be for tools to re-use genome alignment results. Many of the tools have a first step of filtering and aligning input data to the reference genome and it would be great to be able to just load an already performed set of alignments.
Hi,
Yes that is an idea I have been trying to include over time. miRCat for example, can already use pre-aligned files (if they have been created with .patman for their extension and were aligned using our sequence alignment tool)
I am working on adding these to future tools also.
Just thought I would mention, we already have some scripts that will convert files from SAM/BAM into a format that can be used in the Workbench. I just need to convert these into java so they can be compiled into the program and then it should be fairly simple to at least support these alignments and then to actually create them also. (With any luck!)
Having SAM/BAM support would really be great. I’m very much looking forward to the next release, especially with these changes and the new loci detection tool.
Thanks for your answers and for the continued development.
Hi Nathan,
No worries, the script (although written in Perl) is not too complex for handling this data so will hopefully be a quick conversion and will at least allow SAM/BAM to be used even if at first they cannot be created by the bench.
Watch this space…
Matt
Hi, can you please direct me to documentation describing how to use these tools on the command-line? Thanks!
Hi Jake,
You can find some instructions on the quickstart pages:
http://srna-workbench.cmp.uea.ac.uk/quick-start/
if you need further information please dont hesitate to ask.
Thanks,
Matt
Fantastic, you guys make it too easy! Thanks.
Hi Matt,
The closest I have to an alignment tool is CLC genomics workbench. Is there a specific file-type I must use (extension)?
Thanx,
Marius
Hi Marius,
It needs to be created by the sequence alignment tool in the workbench, you will find it under the helper tools menu. The aligned sequences must be in this format to be used by miRCat.
by the way, dont worry if the reply button does not appear at some point, there is limit on the replies to each post. Just start a new comment if necessary
Thanks,
Matt
Okay, that sounds pretty straightforward.
Thanx and let’s see.
Hi Matt,
I’ve repeated miRCat analysis on a Windows 7 OS 8Gb RAM machine and again an “out of memory error” message appeared. It tells me to enlarge JVM memory. When I run the analysis, however, without selecting plant or animal parameters it does start working.. Would it help getting Java 7 64bit, because it is not installed?
Thanx,
Marius
Hi Marius,
Yes you must use 64bit Java because 32bit programs are all restricted to a maximum of 2GB of RAM (regardless of programming language). If you want to check which java version you have then type java -version into the command line (dos prompt) which can be loaded by typing cmd into the run menu on the Windows7 start bar.
Thanks,
Matt
Hi Matt,
Java 7 64bit is installed on the 8Gb machine, but the program still runs out of memory. What can I do to make it work?
Marius
Hi Marius,
Unfortunately miRCat is currently rather intensive on memory, more than I would have hoped. I am working on a way of decreasing the footprint but it is not ready yet. You may find that changing the parameter settings for your data will decrease the amount of memory you use (particularly settings such as the minimum abundance to be considered, if you set this higher then less small RNAs will be used but of course this will decrease the sensitivity of your result set).
If you use the .patman file you created with the sequence alignment tool you may find this process is a little faster.
The other option is to split the analysis up by aligning to single chromosomes or portions of the genome with the sequence alignment tool (and a set of reduced genome files) and using each of these in a separate analysis. This of course means a little more work at your end. Again I am looking into ways of automating this procedure.
I would also recommend ensuring your computer is not running any other intensive programs before you launch the workbench (such as web browsers) as the program will use only the RAM it finds available (i.e total RAM – what ever is being used).
I hope this helps,
Matt
Matt,
Actually just realized that I have BAM files for each sample. I can’t see where in mircat I can import these?
Marius
Hi Matt,
I just got an “out of memory error” message with the newly created patman file. I don’t know what to do now. I’ll see if I can find a computer with more RAM. I have 4Gb of RAM. Unless you have another solution for me?
Cheers,
Marius
Hi Marius,
4GB of RAM may not be enough to complete your analysis, you can either use a bigger machine or have you considered using iPlant? It is a cloud based service hosted in the US:
http://www.iplantcollaborative.org/
They have the Workbench installed on their cluster and creating an account to use it is free. There are many different analysis tools you can use. When logging in and selecting the workbench you will be presented with a virtual desktop that you can then launch the Workbench from. They will only give you 4GB of RAM to begin with but you can request more through email (I think they will give you 32GB if you ask) and I think the default storage allowance is 10GB (you may need more depending on the size of your dataset.
It is a bit of an effort to set it up and transfer your data to their cloud but once you have done it you can then continue to use it for further analysis.
miRcat does not work on tqo different MAC desktops (operating systems 10.7.5). Installation appears fine however when miRCat fails to produce an output file. The output, “successfully completed”, is observed however there is no data. The exactly same files (sRNA and genome sequence) and sRNA tools version were downloaded onto another Mac (10.6.8) and it works as expected
Hi Iain,
That is very strange. I am running MAC OS 10.7.5 as my main development platform and have not experienced any differences as yet. Can you confirm which version of Java you are using? Also are the spec of the two machines (hardware) the same?
Edit: Just noticed you wrote sRNA tools rather than Workbench. Can you confirm this post relates to the sRNA Workbench (Java) or the tools (Perl)?
Thanks,
Matt
Java version- 1.6.0_37 Build 110613 . Confirm problem is with Workbench.
Hi Iain,
I have run further tests with miRCat today and still find no differences when running data through my main Lion machine and an older Snow leopard install. Could you zip up the log files for me (User/logs) and send them to matthew.stocks@uea.ac.uk
Perhaps they will shed some light as to what is happening on your machine.
Thanks,
Matt
Can you explain me the output of Plant target prediction tool?
Hi,
There is a full pdf of documentation for the downloadable srna-toolkit. The scripts are pretty much the same as the ones being run on the web-based version. There is a chapter on the original plant target prediction tool that should hopefully explain the output a little better. You can find the pdf here:
http://srna-workbench.cmp.uea.ac.uk/doc/documentation.pdf
In the UEA sRNA toolkit plant version the plant target prediction tool uses target finder as back hand tool for target prediction for plants?
Hi,
No the plant target prediction tool does not use targetfinder, it is something written here but the results of the two tools are likely to be very similar. Further documentation on the tool and the targeting rules that it uses can be found here:
http://srna-tools.cmp.uea.ac.uk/plant/cgi-bin/srna-tools.cgi?rm=document&page=target_help
Why is the hairpin GFF file cannot be viewed by VSR or any other genome viewers ?
Please not that in version 2.3.1 still the rendering of the hairpin is wrong coloring an extra base in the 5 prime of the miRNA and miRNA star. Can you fix this ?
Thanks
Tzahi
Hi Tzahi,
we are currently looking into this issue and will attempt to get it fully functional for our next release. Thanks for the report.
How does sRNA workbench calculate normalised count for organisms other than the reference genome provided? Does it work on homology basis?
In SiLoCo we normalise using genome matching reads (per-total). In the next version we will be able to perform normalisation on all reads (with and without a genome) using various new methods.
How does miRprof calculate normalised count for organisms other than the reference genome provided? Does it work on homology basis?
miRProf calculates normalised counts in the same way as SiLoCo (see reply above)
Ya i got it.Thank you
Can we find differentially expressed miRNA’s using sRNA workbench?
For example if we want to compare expression of 2 miRNA samples(control and treated). Is it possible to get list of up regulated and down regulated miRNA’s?
Currently we are developing a new tool to be added into the Workbench called FiRePat (Finding Regulatory Patterns) which we aim to release in the near future. In this tool we will implement the current methods for determining differentially expressed sRNA in multiple sample experiments.
A web based version of FiRePat is currently available from our original tools website (http://srna-tools.cmp.uea.ac.uk)
I will add a post to the feed when the new tool is available.
Will this tool work for SOLiD small RNA data?
Hi,
Unfortunately not, it is something we intend on looking into for the future, but there are several issues that would require considerable work to make the software work directly on SOLiD data.
We currently recommend converting the data into base space in order to use these tools but we have not tested this method (I am aware that they may be several issues with this kind of conversion!)
Please feel free to contact me for any further information.
Matt
Thank you for the information it was very useful
No problem
We are running some tests on a workaround solution as we speak and with any luck will put out a small release in the next few hours that will allow the workbench to run on Java 1.7
Thanks,
Matt
Hi,
I have a small RNA data set of illumina.
I am not able to update the miRBase database files.
So please guide me in solving this problem.
Can you also explain when and how is miRBase being used?
Regards,
Chintan Vora
Hi,
you may be experiencing an issue related to Java 1.7 when attempting to download/update miRBase files (related to support for IPv4, Java are aware of the problem but I am not sure when their updated code will be available). We are attempting to add a work-around at the moment.
The software should work fine on Java 1.6 (any update). If you want instruction on how to use an earlier version of Java please let me know.
miRBase is used for miRProf to determine known miRNA within your sRNA datasets. It is also used in miRCat to inform you of any predicted miRNA that are already found in miRBase.
I hope this helps,
Matt
Dear Matt,
I am currently having problems in mircat. After loading my .fa sample file and genome file and start the run, an error message appears telling me that it “system cannot find vvi12x.fa.patman file”… I don’t get this since the file’s name is “vvi12x.fa” and I specifically choose to open a FASTA file extension. Can you please assist/help me out to overcome this problem.
Kind regards,
Marius
Hi Marius,
could you let me know which OS you are using?
Thanks,
Matt
Hi Matt,
I’m using a Windows 7 64bit machine. Earlier it seemed like mircat actually started running, but it went on for an hour without progress (progress bars stayed empty).
Marius
Hi Marius,
could you attempt to align the small RNA sequences to the genome using the sequence alignment tool? You can use the files it produces directly within miRCat and that will tell me if there was a problem executing patman.
Thanks,
Matt